View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5147_low_11 (Length: 250)

Name: NF5147_low_11
Description: NF5147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5147_low_11
NF5147_low_11
[»] chr7 (1 HSPs)
chr7 (6-101)||(6323184-6323279)


Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 6 - 101
Target Start/End: Complemental strand, 6323279 - 6323184
Alignment:
6 aggagcacagagacaaatcgccgccacaaacacaagcgaggaaaacagtgatgatcgaactgaattcactccacaaaaagaattgaattttgtgaa 101  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6323279 aggaacactgagacaaatcgccgccacaaacacaagcgaggaaaacagtgatgatcgaactgaattcactccacaaaaagaattgaattttgtgaa 6323184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University