View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5147_low_13 (Length: 240)

Name: NF5147_low_13
Description: NF5147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5147_low_13
NF5147_low_13
[»] chr2 (2 HSPs)
chr2 (1-109)||(16797443-16797551)
chr2 (138-223)||(16797323-16797408)


Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 16797551 - 16797443
Alignment:
1 ttgggcgcctatgaaagtgtccaccttgtcgtggcaactacttttggataggctgccgatgaaattcaatttgcatcggagagggattatccctcaagtg 100  Q
    |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16797551 ttgggctcctatgaaagtgtccaccttgtcatggcaactacttttggataggctgccgatgaaattcaatttgcatcggagagggattatccctcaagtg 16797452  T
101 gactccaaa 109  Q
    |||||||||    
16797451 gactccaaa 16797443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 138 - 223
Target Start/End: Complemental strand, 16797408 - 16797323
Alignment:
138 ggaactcgtctaaacaggctttacatcttttcctgcattgtaattttgtatccgctgtttggtatgaagtgttccattggcttgtt 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
16797408 ggaactcgtctaaacaggctttacatcttttcctgcattgtaattttgtatccgctgtttggtatgaagtgtcccattggcttgtt 16797323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University