View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5148-Insertion-11 (Length: 244)
Name: NF5148-Insertion-11
Description: NF5148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5148-Insertion-11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 37 - 244
Target Start/End: Original strand, 41310616 - 41310819
Alignment:
| Q |
37 |
gtgtttggatgtatgtgacgaattaacagctctaaatgaaggataaggccggctctgaagtcaattgggaagagaattaatatctatctaaataggaggg |
136 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41310616 |
gtgtttggatgtatgtgacaaattaacagctctaaatgaaggataaggccggctctgaagtcaattgggaagagaattaatatc----taaataggaggg |
41310711 |
T |
|
| Q |
137 |
tacattacaaacataagagacatatggaggactttactatttgcattttgttatgtatgctactagtaaattagtattggcaggctggtgcatgttagtt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41310712 |
tacattacaaacataagagacatatggaggactttactatttgcattttgttatgtatgctactagtaaattagtattggcaggctggtgcatgttagtt |
41310811 |
T |
|
| Q |
237 |
agttccac |
244 |
Q |
| |
|
|||||||| |
|
|
| T |
41310812 |
agttccac |
41310819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University