View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5148_high_19 (Length: 210)
Name: NF5148_high_19
Description: NF5148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5148_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 9e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 23 - 161
Target Start/End: Complemental strand, 2625944 - 2625806
Alignment:
| Q |
23 |
tctcattcttatgtccataacaatgcaatatgctaagtgtttaaacaagtgaaccaccaaaatttgtgaatagacaaaaacaaactcgaaattaaaatac |
122 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2625944 |
tctcattcttatgtccataacaatacattatgctaagtgtttaaacaagtgaaccaccaaaatttgtaaatagacaaaaacaaactcgaaattaaaatac |
2625845 |
T |
 |
| Q |
123 |
tgcaataattgacacgtttacaattttaagtaactatca |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625844 |
tgcaataattgacacgtttacaattttaagtaactatca |
2625806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 2380730 - 2380687
Alignment:
| Q |
154 |
aactatcactatggagtatcattatcatctaagttattcttctc |
197 |
Q |
| |
|
|||||| |||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
2380730 |
aactatgactatgcagtatcattaccatctaagttattcttctc |
2380687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University