View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5149_high_4 (Length: 233)
Name: NF5149_high_4
Description: NF5149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5149_high_4 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 28382674 - 28382457
Alignment:
| Q |
16 |
gatagtatgatgtttgagtatgattgcatgtgtcgcgtttcacctaaacctgcaaggatgaaggtttttctcttccctctccctgttaacaatgcatctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28382674 |
gatagtatgatgtttgagtatgattgcatgtgtcgcgtttcacctaaacctgcaaggatgaaggtttttctcttccctctcccagttaacaatgcatctt |
28382575 |
T |
 |
| Q |
116 |
ctgattctttggattccgctttcaatcttgcggtggtggaagattcgaaatccgacggacaaatgttcgtcaacatgctcaattccgttcatcgtccacc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28382574 |
ctgattctttggattccgctttcaatcttgcggtggtggaagattcgaaatccgacggacaaatgttcgtcaacatgctcaattccgttcatcgtccacc |
28382475 |
T |
 |
| Q |
216 |
gccggtggaagatttatc |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28382474 |
gccggtggaagatttatc |
28382457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 107
Target Start/End: Original strand, 38443424 - 38443510
Alignment:
| Q |
21 |
tatgatgtttgagtatgattgcatgtgtcgcgtttcacctaaacctgcaaggatgaaggtttttctcttccctctccctgttaacaa |
107 |
Q |
| |
|
||||||||| ||||||||| | ||||||| | |||||| || |||||| || ||| ||| || ||||||||| ||||||||||||| |
|
|
| T |
38443424 |
tatgatgttcgagtatgatcgtatgtgtcacttttcacgaaagcctgcatggttgagggtcttcctcttccctgtccctgttaacaa |
38443510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University