View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5149_low_3 (Length: 365)
Name: NF5149_low_3
Description: NF5149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5149_low_3 |
 |  |
|
| [»] scaffold0056 (5 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (4 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 2e-22; HSPs: 190)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 223 - 308
Target Start/End: Complemental strand, 52442091 - 52442006
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52442091 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
52442006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 8760780 - 8760725
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8760780 |
gctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgt |
8760725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 13479610 - 13479555
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13479610 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
13479555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 22584288 - 22584343
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22584288 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgt |
22584343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 28809012 - 28809067
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28809012 |
gctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgt |
28809067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 9289267 - 9289321
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9289267 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 46088059 - 46088005
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46088059 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 50714564 - 50714510
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50714564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 308
Target Start/End: Complemental strand, 52430099 - 52430014
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52430099 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
52430014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 24474962 - 24474909
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24474962 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 13064464 - 13064409
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
13064464 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
13064409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 13073760 - 13073815
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13073760 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
13073815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 13631229 - 13631284
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13631229 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
13631284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 16712690 - 16712635
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
16712690 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
16712635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 22099911 - 22099856
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
22099911 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgt |
22099856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 25423925 - 25423980
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25423925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
25423980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 25424311 - 25424256
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25424311 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
25424256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 29380909 - 29380858
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29380909 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
29380858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 32365482 - 32365427
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
32365482 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
32365427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 34361804 - 34361855
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34361804 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34361855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 35464019 - 35464074
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35464019 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
35464074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 36702001 - 36702056
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
36702001 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
36702056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 52017506 - 52017561
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
52017506 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
52017561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 52017869 - 52017814
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
52017869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
52017814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 52441764 - 52441819
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
52441764 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
52441819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 53717173 - 53717118
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
53717173 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
53717118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 5882553 - 5882637
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5882553 |
gctaaaatatggttttagtcct-gcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
5882637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 6827547 - 6827597
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6827547 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 8760605 - 8760690
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||| | |||| ||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8760605 |
gctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
8760690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 277
Target Start/End: Complemental strand, 9289634 - 9289584
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9289634 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 14791805 - 14791751
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14791805 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 18205521 - 18205467
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
18205467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35415632 - 35415578
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35415632 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35415578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 35420701 - 35420647
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgt |
35420647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 35763648 - 35763702
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35763648 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 41345854 - 41345908
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
41345854 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 43231089 - 43231143
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43231089 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 43368467 - 43368521
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
43368521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 46115778 - 46115724
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
46115778 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 46128912 - 46128858
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
46128912 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 224 - 308
Target Start/End: Original strand, 9445951 - 9446035
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
9446035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 13479273 - 13479326
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 18205157 - 18205210
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
18205157 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 29420536 - 29420483
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29420536 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 32208543 - 32208596
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
32208543 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 38054549 - 38054602
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
38054602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 51545966 - 51545913
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
51545913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 41619902 - 41619954
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 2034854 - 2034799
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
2034854 |
gctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgt |
2034799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 2180221 - 2180276
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
2180221 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
2180276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 4279023 - 4279078
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
4279023 |
gctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgt |
4279078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 5827656 - 5827711
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
5827656 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
5827711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 5827972 - 5827917
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
5827972 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgt |
5827917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 11285504 - 11285559
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
11285559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 11693120 - 11693065
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
11693120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgt |
11693065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 12152492 - 12152437
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
12152492 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgt |
12152437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 13064160 - 13064215
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
13064160 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
13064215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 13530712 - 13530657
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
13530712 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
13530657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 13764614 - 13764669
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
13764614 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgt |
13764669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 14488186 - 14488131
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
14488186 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
14488131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 19321858 - 19321803
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
19321858 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgt |
19321803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 22099544 - 22099595
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
22099544 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22099595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 23245594 - 23245539
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23245594 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgt |
23245539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 23779224 - 23779169
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
23779224 |
gctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgt |
23779169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 24774046 - 24774101
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
24774046 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
24774101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 27008085 - 27008140
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
27008085 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27008140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 29463912 - 29463857
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
29463912 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgt |
29463857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 31560694 - 31560639
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
31560694 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
31560639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 31812212 - 31812157
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || | |||||||||||||||||||||||||||||||||| |
|
|
| T |
31812212 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
31812157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 32365095 - 32365150
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
32365095 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
32365150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 36050289 - 36050344
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgt |
36050344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 41346217 - 41346166
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
41346217 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
41346166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 42848028 - 42848083
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || | |||||||||||||||||||||||||||||||||| |
|
|
| T |
42848028 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
42848083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 43231388 - 43231333
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
43231388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
43231333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 45505601 - 45505656
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
45505601 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
45505656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 45505893 - 45505838
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
45505893 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 45593585 - 45593530
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
45593585 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgt |
45593530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 46115415 - 46115470
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
46115415 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
46115470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 46128549 - 46128604
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
46128549 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
46128604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 47532667 - 47532616
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgt |
47532616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 270
Target Start/End: Original strand, 52543423 - 52543470
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52543423 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 53308067 - 53308012
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
53308067 |
gctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgt |
53308012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 53716922 - 53716973
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
53716922 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
53716973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 55072390 - 55072445
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
55072390 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
55072445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 123535 - 123589
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
123535 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 6827873 - 6827819
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
6827873 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 13631598 - 13631544
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
13631598 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 18831176 - 18831122
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| || |||||||||| |||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgt |
18831122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19903603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 23245232 - 23245286
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
23245232 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 26412191 - 26412245
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26412191 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 26412583 - 26412529
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
26412583 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 27427873 - 27427926
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
27427873 |
gctaaaatatgg-tttagtccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 28448835 - 28448885
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
28448835 |
gctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 29380669 - 29380723
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
29380669 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctg |
29380723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 29499183 - 29499237
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29499183 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 30046791 - 30046737
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
30046791 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 30061132 - 30061078
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
30061132 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 30564835 - 30564889
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| | |||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgt |
30564889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35464381 - 35464327
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35464381 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 42848390 - 42848336
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
42848390 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 50714241 - 50714295
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
50714241 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 51708694 - 51708744
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
51708694 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 53916046 - 53915992
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
53916046 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 23778965 - 23779014
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
23778965 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 28809179 - 28809126
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
28809179 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 54208822 - 54208769
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
54208769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 55072709 - 55072656
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
55072656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 2322431 - 2322376
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
2322431 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgt |
2322376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 4279334 - 4279283
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
4279334 |
gctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtcc |
4279283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 5052583 - 5052532
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||| ||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
5052583 |
gctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
5052532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 6353637 - 6353582
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt |
6353582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 8191390 - 8191335
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
8191390 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt |
8191335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 9446322 - 9446267
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
9446322 |
gctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgt |
9446267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 12791973 - 12791918
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
12791973 |
gctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgt |
12791918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 14487803 - 14487858
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
14487803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgt |
14487858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 18136112 - 18136057
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
18136112 |
gctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt |
18136057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 26314331 - 26314276
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
26314331 |
gctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgt |
26314276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 27008401 - 27008350
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| ||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
27008350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 28449213 - 28449166
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
28449213 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 31182503 - 31182448
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| | | |||||||||||||||||||||||| ||||||||| |
|
|
| T |
31182503 |
gctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgt |
31182448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 31811926 - 31811981
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
31811926 |
gctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgt |
31811981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 34355282 - 34355227
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
34355282 |
gctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgt |
34355227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 36702362 - 36702307
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||| | |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgt |
36702307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 37556842 - 37556897
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
37556842 |
gctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgt |
37556897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 41921083 - 41921032
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
41921083 |
gctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 42823777 - 42823832
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
42823777 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgt |
42823832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 46292650 - 46292595
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| |||||||||||||| |||| |
|
|
| T |
46292650 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgt |
46292595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
47136119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 49123320 - 49123265
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
49123320 |
gctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt |
49123265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 51545630 - 51545685
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
51545630 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgt |
51545685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 51738138 - 51738193
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
51738138 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgt |
51738193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 54903474 - 54903419
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| | ||||||||||||||||||||| |
|
|
| T |
54903474 |
gctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
54903419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 55482467 - 55482412
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
55482467 |
gctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgt |
55482412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 4211562 - 4211616
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
4211562 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
4211616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 13530380 - 13530434
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
13530380 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 25358539 - 25358485
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| ||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
25358539 |
gctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 35415300 - 35415354
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
35415300 |
gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35763954 - 35763900
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||||| |||| ||||| |||||||||||||||||||||| |
|
|
| T |
35763954 |
gctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctg |
35763900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 41620255 - 41620201
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
41620255 |
gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 44925486 - 44925536
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
44925486 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 46292393 - 46292447
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
46292393 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 47023104 - 47023050
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
47023104 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 51709026 - 51708976
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
51709026 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 51830891 - 51830945
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| | |||||||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctgt |
51830945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 53915684 - 53915738
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
53915684 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 245 - 278
Target Start/End: Original strand, 5797504 - 5797537
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5797504 |
tgcaaatatgtctcgttttggttttagtccctgt |
5797537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 32208900 - 32208847
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||| ||||||||||| |
|
|
| T |
32208900 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 47274229 - 47274180
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||| | |||||| | |||||||||||||||||||||||||||| |
|
|
| T |
47274229 |
gctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 275
Target Start/End: Complemental strand, 123893 - 123845
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||| |||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 5797817 - 5797765
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| | |||||||||||||||||||||||| |||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 227 - 278
Target Start/End: Original strand, 2034544 - 2034595
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
2034595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 2180571 - 2180520
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||| | |||||||| |||||||||| | ||||||||||||||||| |
|
|
| T |
2180571 |
gctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtcc |
2180520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 2322094 - 2322149
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| | |||||||| ||||||||||||||||| ||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgt |
2322149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 12152155 - 12152210
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||| |||||||||||||| |
|
|
| T |
12152155 |
gctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgt |
12152210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 13074124 - 13074073
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
13074124 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
13074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 13764806 - 13764755
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| || |||||||| |||||||||||||||||| |
|
|
| T |
13764806 |
gctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 14594207 - 14594258
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
14594207 |
gctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 20291987 - 20292042
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
20291987 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctgt |
20292042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 22584606 - 22584551
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| ||| ||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
22584606 |
gctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgt |
22584551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 24474601 - 24474651
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
24474601 |
gctaaaatatggttttagtcct-gcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 26313989 - 26314044
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
26313989 |
gctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgt |
26314044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 35119293 - 35119348
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35119293 |
gctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgt |
35119348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 35119610 - 35119559
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
35119610 |
gctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 36054149 - 36054094
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| || ||| |||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
36054149 |
gctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
36054094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 37557194 - 37557139
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||| ||||||||| ||||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgt |
37557139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 41324889 - 41324834
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || |||||||||| ||||||||||||||||||||||| |
|
|
| T |
41324889 |
gctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgt |
41324834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 42824090 - 42824039
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
42824090 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc |
42824039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 44925844 - 44925789
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgt |
44925789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 45474595 - 45474540
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| ||||||||||||| |||| |
|
|
| T |
45474595 |
gctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctgt |
45474540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 45593229 - 45593284
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| | |||||||| |||||||||| |||||||||||| |
|
|
| T |
45593229 |
gctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgt |
45593284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 50822293 - 50822238
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||| | ||| ||||||||||||| |
|
|
| T |
50822293 |
gctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtccctgt |
50822238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 16712331 - 16712385
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||| ||| |||||||||| ||||||||||| |||||| |||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtctctgt |
16712385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 31560332 - 31560386
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
31560332 |
gctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 51738410 - 51738356
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||| |||| ||||||| |
|
|
| T |
51738410 |
gctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 278
Target Start/End: Complemental strand, 7642629 - 7642596
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
7642629 |
tgcaaatatgtttcgttttggttttagtccctgt |
7642596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 14791502 - 14791555
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| ||| |||||||||||||| |||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgt |
14791555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 20144497 - 20144534
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
20144497 |
gtccctgcaaatatgtctcgttttggttttggtccctg |
20144534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 277
Target Start/End: Complemental strand, 25358495 - 25358454
Alignment:
| Q |
236 |
tttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | ||||||| |
|
|
| T |
25358495 |
tttagtccctgcaaatatgtctcgttttggttgtggtccctg |
25358454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 50753925 - 50753978
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| ||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgt |
50753978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgtttt-ggttttagtccct |
276 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 276
Target Start/End: Complemental strand, 14594489 - 14594453
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
14594489 |
gtccctgcaaatatgtctcgttttggttttggtccct |
14594453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| |||||||| || ||||||| || |||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 238 - 278
Target Start/End: Original strand, 54208477 - 54208517
Alignment:
| Q |
238 |
tagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
54208477 |
tagtccctgcaaatatgcctcattttggttttagtccctgt |
54208517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 276
Target Start/End: Complemental strand, 54903398 - 54903362
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
54903398 |
gtccctgcaaatatgtctcgttttggttttggtccct |
54903362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 2e-22; HSPs: 161)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 24483401 - 24483486
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
24483486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 2265396 - 2265341
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265396 |
gctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgt |
2265341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 11713486 - 11713541
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11713486 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
11713541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 11788415 - 11788360
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11788415 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
11788360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 36622251 - 36622306
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36622251 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
36622306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 43592047 - 43592102
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43592047 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
43592102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 5790898 - 5790844
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5790898 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 19183783 - 19183837
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19183783 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 26813867 - 26813921
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26813867 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 1497611 - 1497666
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
1497611 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt |
1497666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 4424184 - 4424129
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4424184 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
4424129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 9195055 - 9195110
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
9195055 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
9195110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 10375068 - 10375013
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
10375068 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgt |
10375013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 10671940 - 10671889
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10671940 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
10671889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 13215061 - 13215116
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13215061 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
13215116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 20939324 - 20939269
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
20939269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 24483890 - 24483835
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
24483890 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
24483835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 25705086 - 25705141
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25705086 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
25705141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 29865510 - 29865455
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29865510 |
gctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgt |
29865455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 33732863 - 33732918
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
33732863 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33732918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 40302338 - 40302283
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
40302338 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
40302283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 41693675 - 41693730
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
41693675 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
41693730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 44559063 - 44559118
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44559063 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
44559118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 44985983 - 44985928
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44985983 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
44985928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 45442695 - 45442644
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45442695 |
gctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 2481194 - 2481248
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2481194 |
gctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 16900205 - 16900151
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
16900205 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16900151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 16993596 - 16993542
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
16993596 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16993542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 19184150 - 19184096
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
19184150 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 20131318 - 20131372
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20131318 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 22881614 - 22881699
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
22881614 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaattgtttttggtccctgcaaaa |
22881699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 26239159 - 26239105
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
26239159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 26814228 - 26814174
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
26814228 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 33576116 - 33576062
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33576116 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 37271740 - 37271794
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37271740 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 37272101 - 37272047
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37272101 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 38639413 - 38639463
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38639413 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 38731830 - 38731915
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||| | |||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38731830 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
38731915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 38980252 - 38980198
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38980252 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 41451838 - 41451892
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41451838 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Complemental strand, 43597498 - 43597413
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43597498 |
gctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
43597413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 44985623 - 44985677
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
44985677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 25954423 - 25954370
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt |
25954370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 26238816 - 26238869
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
26238869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 27311068 - 27311015
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
27311068 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 42358702 - 42358755
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
42358755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 42695869 - 42695922
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42695869 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 36806892 - 36806840
Alignment:
| Q |
226 |
aaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
36806840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 146689 - 146634
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
146689 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgt |
146634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 2481556 - 2481501
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
2481556 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
2481501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 3671004 - 3671059
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
3671004 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt |
3671059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 3671187 - 3671136
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3671136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 3837934 - 3837989
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
3837934 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgt |
3837989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 3838263 - 3838208
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
3838208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 4423896 - 4423951
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
4423896 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
4423951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 8046330 - 8046385
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
8046330 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt |
8046385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 8046647 - 8046592
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
8046647 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
8046592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 9195205 - 9195150
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||| || |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9195205 |
gctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgt |
9195150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 10374775 - 10374830
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
10374830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 10664985 - 10665040
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| | ||||||||||| |
|
|
| T |
10664985 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgt |
10665040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 10671631 - 10671686
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
10671631 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgt |
10671686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 11713844 - 11713789
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| || |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
11713844 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
11713789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 16522992 - 16523047
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
16522992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
16523047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 16523324 - 16523269
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
16523324 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
16523269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 17302142 - 17302087
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || | |||||||||||||||||||||||||||||||||| |
|
|
| T |
17302142 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
17302087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 17541775 - 17541724
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
17541775 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
17541724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 29859871 - 29859816
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29859871 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
29859816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 29865222 - 29865277
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29865277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 31326251 - 31326196
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | ||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
31326251 |
gctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgt |
31326196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 31644842 - 31644897
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
31644842 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
31644897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 36815834 - 36815779
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
36815834 |
gctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgt |
36815779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 40786461 - 40786516
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
40786461 |
gctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgt |
40786516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 41694002 - 41693947
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
41694002 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
41693947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 43597155 - 43597210
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
43597155 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt |
43597210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 43710707 - 43710652
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43710707 |
gctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgt |
43710652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 43788859 - 43788910
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
43788859 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 4794131 - 4794185
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4794131 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 5334752 - 5334806
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
5334752 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 5335039 - 5334985
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
5335039 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 5790559 - 5790613
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
5790559 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 14003741 - 14003687
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
14003741 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 15842822 - 15842768
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
15842822 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 16673412 - 16673466
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
16673412 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 17541383 - 17541437
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
17541383 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 20131680 - 20131626
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
20131680 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 24358617 - 24358671
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24358617 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 25705448 - 25705394
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
25705448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 33575753 - 33575807
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33575753 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 228 - 274
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
| Q |
228 |
aatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 44073806 - 44073752
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
44073806 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 44559407 - 44559353
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
44559353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 19831511 - 19831564
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt |
19831564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 240 - 308
Target Start/End: Complemental strand, 22881950 - 22881882
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
22881882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 33733240 - 33733187
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
33733240 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 17912452 - 17912500
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
17912500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 1138358 - 1138303
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
1138358 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgt |
1138303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 3172531 - 3172480
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3172531 |
gctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 4042889 - 4042838
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
4042889 |
gctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 7814736 - 7814681
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7814736 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
7814681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 12835326 - 12835381
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
12835326 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
12835381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 18113090 - 18113145
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
18113090 |
gctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgt |
18113145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 20658062 - 20658117
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||| |||| |||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
20658062 |
gctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
20658117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 25954116 - 25954167
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25954116 |
gctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc |
25954167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 27310877 - 27310931
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
27310877 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctgt |
27310931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 30215870 - 30215815
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
30215870 |
gctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgt |
30215815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 31226076 - 31226021
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
31226076 |
gctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgt |
31226021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 34317799 - 34317854
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
34317799 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
34317854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 34964158 - 34964103
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
34964158 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgt |
34964103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 37228734 - 37228789
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
37228734 |
gctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgt |
37228789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 38979890 - 38979945
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatat-gtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
38979890 |
gctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg |
38979945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 40301976 - 40302031
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| |||| |||||||||||||| |
|
|
| T |
40301976 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgt |
40302031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 44994060 - 44994005
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
44994060 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgt |
44994005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 1137983 - 1138037
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgt |
1138037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 7814247 - 7814301
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| | |||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
7814247 |
gctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 269
Target Start/End: Complemental strand, 13215364 - 13215318
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttt |
269 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
13215364 |
gctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 14003410 - 14003464
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
14003410 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 16673770 - 16673716
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
16673770 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 23989839 - 23989889
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
23989839 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 24358944 - 24358890
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24358944 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 26707874 - 26707959
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26707874 |
gctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
26707959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 30215423 - 30215477
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
30215423 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 41791020 - 41791074
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt |
41791074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 43789191 - 43789137
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
43789191 |
gctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 44993806 - 44993859
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| | ||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcct-gcaaatatgtctcgttttggttttactccctgt |
44993859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| | | |||||||||||||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 16968555 - 16968608
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| | |||||||| || |||||||||||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgt |
16968608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 27109074 - 27109127
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
27109074 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||| |||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 276
Target Start/End: Original strand, 43710395 - 43710435
Alignment:
| Q |
236 |
tttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
43710395 |
tttagtcccttcaaatatgtctcgttttggttttagtccct |
43710435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 4042611 - 4042662
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
4042611 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 4794468 - 4794417
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| ||| |||| | ||||||||||||||||||||||||||| |||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgt |
4794417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 14393127 - 14393077
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
14393127 |
gctaaaatatga-tttagttcctgcaaatatgtctcgttttggttttagtcc |
14393077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 23732040 - 23732091
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
23732040 |
gctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc |
23732091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 29182169 - 29182224
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
29182169 |
gctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtctctgt |
29182224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 31325921 - 31325976
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| | |||||| |||||||||| ||||||| |||||||||||||| |
|
|
| T |
31325921 |
gctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgt |
31325976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 32476096 - 32476151
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
32476096 |
gctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgt |
32476151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 32691314 - 32691369
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
32691314 |
gctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgt |
32691369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 35155618 - 35155563
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| || |||||||||| |||||| ||||||||||||| |
|
|
| T |
35155618 |
gctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgt |
35155563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 37910757 - 37910812
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
37910757 |
gctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgt |
37910812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 37911119 - 37911064
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
37911119 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgt |
37911064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 40124967 - 40125022
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
40124967 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgt |
40125022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 41791311 - 41791256
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||| |||| |||| |
|
|
| T |
41791311 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtctctgt |
41791256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 42696202 - 42696151
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 43672317 - 43672262
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||| | |||||||||||||||||||| |
|
|
| T |
43672317 |
gctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgt |
43672262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 270
Target Start/End: Original strand, 45442317 - 45442364
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
45442317 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Complemental strand, 20658408 - 20658362
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttt |
269 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||| |||| |
|
|
| T |
20658408 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 26709697 - 26709747
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
26709697 |
gctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 248 - 278
Target Start/End: Original strand, 36815514 - 36815544
Alignment:
| Q |
248 |
aaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36815514 |
aaatatgtctcgttttggttttagtccctgt |
36815544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 278
Target Start/End: Complemental strand, 1295524 - 1295491
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
1295524 |
tgcaaatatgtttcgttttggttttagtccctgt |
1295491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 272
Target Start/End: Original strand, 11943543 - 11943588
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
11943543 |
aaatatggttttagtcaatgcgaatatgtctcgttttggttttagt |
11943588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 278
Target Start/End: Original strand, 13850545 - 13850578
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
13850545 |
tgcaaatatgtctcgatttggttttagtccctgt |
13850578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 277
Target Start/End: Complemental strand, 33576072 - 33576031
Alignment:
| Q |
236 |
tttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
33576072 |
tttagtccctgcaaatatgtctcattttggttttggtccctg |
33576031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 263
Target Start/End: Complemental strand, 32691634 - 32691594
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgtttt |
263 |
Q |
| |
|
||||||| |||| |||||||| ||||||||||||||||||| |
|
|
| T |
32691634 |
gctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 9e-21; HSPs: 155)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 10744053 - 10743998
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10744053 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt |
10743998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 14318046 - 14318097
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14318046 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
14318097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 26133412 - 26133357
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26133412 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
26133357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 36577723 - 36577778
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36577723 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
36577778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 42207243 - 42207298
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42207243 |
gctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgt |
42207298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 45139 - 45194
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45139 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
45194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 1381248 - 1381303
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1381248 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
1381303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 2217495 - 2217550
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
2217495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
2217550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 4203769 - 4203714
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
4203769 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
4203714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 5950177 - 5950232
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
5950177 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
5950232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 7075573 - 7075628
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
7075573 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
7075628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 9179594 - 9179649
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9179594 |
gctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgt |
9179649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 9179919 - 9179864
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
9179919 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgt |
9179864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 11799457 - 11799402
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
11799457 |
gctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgt |
11799402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 18046039 - 18046094
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
18046039 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
18046094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 21124914 - 21124969
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21124914 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
21124969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 24781990 - 24782045
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24781990 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24782045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 28550828 - 28550883
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
28550828 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28550883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 28863511 - 28863566
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
28863511 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28863566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 28863837 - 28863782
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
28863837 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28863782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 29366948 - 29366893
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
29366948 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
29366893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 29692745 - 29692800
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29692745 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29692800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 30800495 - 30800550
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
30800495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30800550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 30800849 - 30800794
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
30800849 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30800794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 30888161 - 30888216
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30888161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
30888216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 33336025 - 33335970
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
33336025 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt |
33335970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 35928457 - 35928402
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35928457 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
35928402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 36578082 - 36578027
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
36578082 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
36578027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 40029496 - 40029441
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
40029496 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
40029441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 40168007 - 40167952
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40168007 |
gctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgt |
40167952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 277
Target Start/End: Complemental strand, 3850594 - 3850544
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3850594 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 5917127 - 5917181
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5917127 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 6912855 - 6912801
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
6912801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 18633600 - 18633654
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
18633600 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 19565468 - 19565522
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19565468 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 19685018 - 19685072
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19685018 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 29172885 - 29172831
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29172885 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 29875724 - 29875670
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29875724 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35167164 - 35167110
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35167164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 38496781 - 38496727
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
38496781 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 2217853 - 2217800
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
2217853 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 9532532 - 9532483
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
9532483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 15635379 - 15635431
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg |
15635431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 2032939 - 2032888
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||| ||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2032939 |
gctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 4736541 - 4736486
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
4736541 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgt |
4736486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 5614167 - 5614218
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
5614167 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
5614218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 5614529 - 5614474
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
5614529 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
5614474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 10743725 - 10743776
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
10743725 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
10743776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 16038378 - 16038429
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
16038378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16038429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 18046347 - 18046296
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
18046347 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18046296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 18258526 - 18258475
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
18258526 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
18258475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 19685379 - 19685324
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
19685379 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
19685324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 20690734 - 20690789
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
20690734 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
20690789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 23381951 - 23382006
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||||||| ||||| |
|
|
| T |
23381951 |
gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt |
23382006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 24443743 - 24443688
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
24443743 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
24443688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 26133184 - 26133239
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
26133184 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
26133239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 31037740 - 31037693
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
31037740 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 35877051 - 35876996
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
35877051 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgt |
35876996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 38170515 - 38170570
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
38170515 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
38170570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 38786160 - 38786215
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38786160 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
38786215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 40029142 - 40029197
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| || ||||||||||||||||||||||| ||||||| |
|
|
| T |
40029142 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgt |
40029197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 40167787 - 40167842
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||| ||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
40167787 |
gctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
40167842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 1105147 - 1105093
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1105147 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 1381610 - 1381556
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1381610 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 5917459 - 5917405
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
5917459 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 6118498 - 6118444
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
6118498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
6118444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 6912498 - 6912552
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
6912498 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 10408929 - 10408983
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
10408929 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 15635706 - 15635652
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
15635706 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 18633960 - 18633906
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
18633960 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctg |
18633906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 19565830 - 19565776
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
19565830 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 308
Target Start/End: Complemental strand, 21050912 - 21050827
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21050912 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
21050827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 25561706 - 25561760
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
25561706 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35166157 - 35166103
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||| |||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
35166157 |
gctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg |
35166103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 35928065 - 35928119
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35928065 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 37271705 - 37271651
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
37271705 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 40764416 - 40764470
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
40764416 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 4203457 - 4203506
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
4203457 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 38962807 - 38962856
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38962807 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 293829 - 293880
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
293829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 1104859 - 1104914
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
1104859 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgt |
1104914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 3851328 - 3851273
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
3851328 |
gctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgt |
3851273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 5904009 - 5904064
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
5904009 |
gctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgt |
5904064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 13990894 - 13990843
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||| || |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
13990894 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13990843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 17070862 - 17070807
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||||||||| ||||||| |||||| |
|
|
| T |
17070862 |
gctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctgt |
17070807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 20660949 - 20661000
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
20660949 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20661000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 20661310 - 20661255
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
20661310 |
gctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgt |
20661255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 23382296 - 23382245
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
23382296 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 25561998 - 25561951
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
25561998 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 34125308 - 34125359
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||| | |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
34125308 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
34125359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 34125631 - 34125576
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
34125631 |
gctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt |
34125576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 35609304 - 35609359
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35609304 |
gctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgt |
35609359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 36973709 - 36973654
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
36973709 |
gctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgt |
36973654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 37271360 - 37271415
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
37271360 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgt |
37271415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 39379609 - 39379558
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
39379609 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 42553643 - 42553698
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
42553643 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgt |
42553698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 2636670 - 2636720
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| ||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
2636670 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 10409325 - 10409275
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
10409325 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 11799130 - 11799184
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
11799130 |
gctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 16038738 - 16038684
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgt |
16038684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 18258163 - 18258217
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
18258163 |
gctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 20986088 - 20986034
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
20986088 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 24443381 - 24443435
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
24443381 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 29151517 - 29151571
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
29151517 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
29151571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 29151850 - 29151796
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||||||||||| |||| |
|
|
| T |
29151850 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg |
29151796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 29875401 - 29875455
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29875401 |
gctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg |
29875455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 35876689 - 35876743
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35876689 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 40764779 - 40764725
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
40764779 |
gctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 42207570 - 42207517
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtccta-caaatatgcctcgttttggttttagtccctgt |
42207517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 15916287 - 15916340
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
||||||| |||| ||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
15916287 |
gctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 245 - 278
Target Start/End: Complemental strand, 26071593 - 26071560
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26071593 |
tgcaaatatgtctcgttttggttttagtccctgt |
26071560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 27916761 - 27916708
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtctctgt |
27916708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 28108159 - 28108106
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgt |
28108106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 42596814 - 42596761
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt |
42596761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 3850300 - 3850356
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttgg-ttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||| || |||||||||| ||||||||||||| |
|
|
| T |
3850300 |
gctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctgt |
3850356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 20416361 - 20416413
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
20416361 |
gctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc |
20416413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 271
Target Start/End: Original strand, 35166912 - 35166960
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttag |
271 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || ||||||||||||| |
|
|
| T |
35166912 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 1286683 - 1286738
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| || |||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
1286683 |
gctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgt |
1286738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 266
Target Start/End: Original strand, 4736206 - 4736249
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggt |
266 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||| |
|
|
| T |
4736206 |
gctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 12144908 - 12144963
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
12144908 |
gctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgt |
12144963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 17070536 - 17070590
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
17070536 |
gctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctgt |
17070590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 20683748 - 20683803
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
20683748 |
gctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgt |
20683803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 25779161 - 25779106
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || ||||||||||||| ||||| |
|
|
| T |
25779161 |
gctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgt |
25779106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 26071292 - 26071347
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | || |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
26071292 |
gctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgt |
26071347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 27916462 - 27916517
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctgt |
27916517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 28213374 - 28213425
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
28213374 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 28871993 - 28871938
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||| ||||| ||| |||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
28871993 |
gctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt |
28871938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 29693089 - 29693038
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
29693089 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtcc |
29693038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 29855614 - 29855669
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgt |
29855669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 32108809 - 32108864
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||| ||||||| |||||| ||||||| |
|
|
| T |
32108809 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgt |
32108864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 270
Target Start/End: Original strand, 42994069 - 42994116
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
42994069 |
gctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 274
Target Start/End: Complemental strand, 9588593 - 9588559
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
9588593 |
gtccctgcaaatatgtctcgttttggttttagtcc |
9588559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 275
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||||||| |||||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc |
20417963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 270
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 270
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 1287042 - 1286989
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| || ||||||||||| ||||||||||||| ||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgt |
1286989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 5104000 - 5103951
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| ||| || | |||||||||||||| ||||||||||||| |
|
|
| T |
5104000 |
gctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 269
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggtttt |
269 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 15916364 - 15916401
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
15916364 |
gtccttacaaatatgtctcgttttggttttggtccctg |
15916401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||| |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 270
Target Start/End: Original strand, 18286431 - 18286476
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||| |||||| | ||||||||||||| |||||||||||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 18286740 - 18286691
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
||||||| |||| |||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
18286740 |
gctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 20661026 - 20661063
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
20661026 |
gtccttgcagatatgtctcgttttggttttggtccctg |
20661063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 28871716 - 28871753
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
28871716 |
gtccctgcaaatatgtctcattttggttttagtccctg |
28871753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 273
Target Start/End: Original strand, 31602226 - 31602259
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
31602226 |
gtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 278
Target Start/End: Complemental strand, 32109074 - 32109041
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
32109074 |
tgcaaatatgtttcgttttggttttagtccctgt |
32109041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 36973354 - 36973403
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| ||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
36973354 |
gctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 38555082 - 38555030
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
38555082 |
gctaaaatatgg-tttggtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 32888691 - 32888743
Alignment:
| Q |
226 |
aaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| ||| |||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgt |
32888743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 4e-20; HSPs: 170)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 223 - 308
Target Start/End: Complemental strand, 44344788 - 44344703
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44344788 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
44344703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 44403248 - 44403195
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44403248 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 5308324 - 5308379
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5308324 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgt |
5308379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 10358367 - 10358312
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10358367 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
10358312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 19561449 - 19561394
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19561449 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
19561394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 35210514 - 35210459
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35210514 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
35210459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 39832907 - 39832962
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39832907 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
39832962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 308
Target Start/End: Complemental strand, 28911905 - 28911820
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28911905 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
28911820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 37372441 - 37372493
Alignment:
| Q |
226 |
aaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
37372493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 1974010 - 1974065
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
1974010 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
1974065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 12894401 - 12894346
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
12894401 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
12894346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 13769775 - 13769826
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13769775 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
13769826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 17999720 - 17999665
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
17999720 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
17999665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 19757749 - 19757804
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
19757749 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
19757804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 25547489 - 25547434
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
25547489 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
25547434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 27458400 - 27458455
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27458400 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
27458455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 35838336 - 35838281
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35838336 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
35838281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 1006836 - 1006890
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1006836 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 1614560 - 1614614
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1614560 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 6079810 - 6079895
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
6079895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 6108335 - 6108389
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
6108335 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 8144296 - 8144350
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8144296 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 17854151 - 17854205
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt |
17854205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 23399975 - 23399921
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23399975 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 25092161 - 25092215
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25092161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 25988386 - 25988440
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25988386 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 44508721 - 44508775
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
44508721 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 44509053 - 44508999
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
44509053 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 39520727 - 39520674
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgt |
39520674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 48359074 - 48359025
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48359074 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 1614903 - 1614848
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
1614903 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
1614848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 3975550 - 3975605
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3975550 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
3975605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 5234203 - 5234148
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
5234203 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt |
5234148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 6509209 - 6509264
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
6509209 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgt |
6509264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 6509469 - 6509414
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
6509469 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
6509414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 8555798 - 8555743
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
8555798 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
8555743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 9659688 - 9659633
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9659688 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
9659633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 16853588 - 16853533
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
16853588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
16853533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 17999466 - 17999521
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
17999466 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgt |
17999521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 19783816 - 19783867
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19783816 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtcc |
19783867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 20388275 - 20388330
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
20388275 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
20388330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 23816671 - 23816726
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
23816671 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgt |
23816726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 28911578 - 28911633
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
28911578 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgt |
28911633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 35837925 - 35837976
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
35837925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35837976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 37372903 - 37372848
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
37372903 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgt |
37372848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 39520399 - 39520454
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
39520399 |
gctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgt |
39520454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 39719641 - 39719586
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
39719641 |
gctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgt |
39719586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 39833235 - 39833180
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
39833235 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt |
39833180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 45073640 - 45073585
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
45073640 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45073585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 45228917 - 45228862
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
45228917 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
45228862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 225 - 276
Target Start/End: Complemental strand, 45671545 - 45671494
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 46304383 - 46304328
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
46304383 |
gctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
46304328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 46759659 - 46759710
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
46759659 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
46759710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 46759941 - 46759886
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46759941 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgt |
46759886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 46828945 - 46829000
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
46828945 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
46829000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 7431952 - 7432002
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
7431952 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 8144657 - 8144603
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8144657 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 23399613 - 23399667
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
23399613 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 23676451 - 23676397
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
23676451 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 25988748 - 25988694
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
25988748 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 26878070 - 26878016
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
26878070 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 29198304 - 29198358
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
29198304 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 29198661 - 29198607
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29198661 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 30223462 - 30223516
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30223462 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 30709643 - 30709593
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30709643 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 32189388 - 32189334
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
32189334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35015219 - 35015165
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
35015219 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35015165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 39439028 - 39438974
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
39439028 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 44568689 - 44568635
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44568689 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 48192487 - 48192433
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
48192487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 19561155 - 19561204
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
19561155 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 21223747 - 21223694
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
21223747 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 31503780 - 31503727
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtctctgt |
31503727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 45671217 - 45671270
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgt |
45671270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 228 - 268
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
228 |
aatatggctttagtccttgcaaatatgtctcgttttggttt |
268 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 30352563 - 30352615
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||| |||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 489071 - 489016
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
489071 |
gctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgt |
489016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 1559704 - 1559649
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
1559704 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgt |
1559649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 3975837 - 3975786
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3975837 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 5354769 - 5354824
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
5354769 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgt |
5354824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 10358002 - 10358057
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
10358002 |
gctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgt |
10358057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 13770080 - 13770025
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| | ||||||||||||||| ||||| |
|
|
| T |
13770080 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgt |
13770025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 14543711 - 14543762
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14543711 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 18022703 - 18022652
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
18022703 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
18022652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 19465979 - 19465925
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
19465979 |
gctaaaatatggttttagccct-gcaaatatgtctcgtttcggttttagtccctgt |
19465925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 21554752 - 21554697
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || |||||| ||||||||||||| |
|
|
| T |
21554752 |
gctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgt |
21554697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 30223794 - 30223743
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
30223794 |
gctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc |
30223743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 31310366 - 31310421
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
31310366 |
gctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgt |
31310421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 31732102 - 31732157
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
31732102 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
31732157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| ||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 35104290 - 35104239
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
35104290 |
aaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
35104239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 35665878 - 35665933
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
35665878 |
gctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgt |
35665933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 37527421 - 37527366
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgt |
37527366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 41054235 - 41054180
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
41054235 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
41054180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 41364885 - 41364940
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| || | |||||||||||||||||||||||||||||||| |
|
|
| T |
41364885 |
gctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt |
41364940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 44402961 - 44403016
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| | | ||||||||||||||||||| |
|
|
| T |
44402961 |
gctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgt |
44403016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 44958505 - 44958450
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
44958505 |
gctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgt |
44958450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 45021495 - 45021550
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgtttt-ggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
45021495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 45073315 - 45073370
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||| | ||||||||||||||| ||||||| |
|
|
| T |
45073315 |
gctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgt |
45073370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 46829311 - 46829256
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
46829311 |
gctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgt |
46829256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 5233809 - 5233863
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
5233809 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 9659356 - 9659410
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
9659356 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 14739003 - 14738949
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
14739003 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 21554394 - 21554479
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
21554394 |
gctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtccttgtaaaaaaaaattgtttttggtccctgcaaaa |
21554479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 25092547 - 25092493
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
25092547 |
gctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 26877679 - 26877733
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
26877679 |
gctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 27037594 - 27037648
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
27037594 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 30352903 - 30352849
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| | |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
30352903 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30352849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 35104079 - 35104133
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35104079 |
gctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 37952671 - 37952725
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgt |
37952725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 43058752 - 43058806
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| | |||||||| ||||||||||||| |||||| ||||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgt |
43058806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 44568327 - 44568381
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
44568327 |
gctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 16941049 - 16940996
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
16940996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 24717531 - 24717478
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| | | |||||||||||||||||||||||||||| |
|
|
| T |
24717531 |
gctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 35665953 - 35665990
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35665953 |
gtccttgcaaatatgtctcgttttggttttggtccctg |
35665990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 45021855 - 45021806
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| ||||||||||||| |
|
|
| T |
45021855 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 6954862 - 6954914
Alignment:
| Q |
226 |
aaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| ||| |||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtctctgt |
6954914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 271
Target Start/End: Complemental strand, 31732450 - 31732402
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttag |
271 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
31732450 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||| |||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 1007228 - 1007177
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||||||||| ||||||||| |
|
|
| T |
1007228 |
gctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtcc |
1007177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 231 - 278
Target Start/End: Complemental strand, 1271590 - 1271543
Alignment:
| Q |
231 |
atggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
1271543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 2945844 - 2945789
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
2945844 |
gctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgt |
2945789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 3807865 - 3807920
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | ||| || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
3807865 |
gctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgt |
3807920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 5308685 - 5308631
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
5308685 |
gctaaaatatgt-tttagtccctgcaaatatacctcgttttggttttagtccctgt |
5308631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 6589022 - 6589073
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||| |||| |
|
|
| T |
6589022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 6892259 - 6892204
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||| |||||| ||||||| |||||||||||| |
|
|
| T |
6892259 |
gctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgt |
6892204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 11767274 - 11767219
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
11767274 |
gctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgt |
11767219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 12932782 - 12932727
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
12932782 |
gctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgt |
12932727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 16940763 - 16940818
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||| |||||| ||| |||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
16940763 |
gctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgt |
16940818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 21223406 - 21223461
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
21223406 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgt |
21223461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 23817033 - 23816978
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||||||||||| ||||| ||||| |
|
|
| T |
23817033 |
gctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgt |
23816978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 225 - 272
Target Start/End: Original strand, 25547256 - 25547303
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 28262714 - 28262769
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
28262714 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgt |
28262769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 28528906 - 28528961
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || | || ||||||||||||||| ||||||||||||||| |
|
|
| T |
28528906 |
gctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgt |
28528961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 34878124 - 34878077
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
34878124 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 35469881 - 35469936
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35469881 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgt |
35469936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 270
Target Start/End: Original strand, 36684536 - 36684583
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
36684536 |
gctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 39719354 - 39719409
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||| |||||||||||||| |||| |
|
|
| T |
39719354 |
gctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgt |
39719409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 41053843 - 41053898
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
41053843 |
gctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgt |
41053898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 46304087 - 46304138
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| |||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
46304087 |
gctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 46648714 - 46648667
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
46648714 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 48852445 - 48852496
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| |||||||||| |
|
|
| T |
48852445 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
48852496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 48854069 - 48854014
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
48854069 |
gctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgt |
48854014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 6847117 - 6847063
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgt |
6847063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 18926889 - 18926943
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||| | | |||||||| ||||||||||||| ||||||||| |
|
|
| T |
18926889 |
ctaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctgt |
18926943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 18927090 - 18927040
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
18927090 |
gctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 39438742 - 39438792
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| ||| |||| || ||||||| |||||||||||||||||| |
|
|
| T |
39438742 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 273
Target Start/End: Complemental strand, 3808101 - 3808068
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
3808101 |
gtccctgcaaatatgtctcgttttggttttagtc |
3808068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 278
Target Start/End: Complemental strand, 3954171 - 3954138
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
3954171 |
tgcatatatgtctcgttttggttttagtccctgt |
3954138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 6589271 - 6589222
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| || |||||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
6589222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 273
Target Start/End: Original strand, 6887178 - 6887211
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
6887178 |
gtccttgcaaatatgtcttgttttggttttagtc |
6887211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 278
Target Start/End: Original strand, 12894056 - 12894097
Alignment:
| Q |
237 |
ttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggttttaatccctgt |
12894097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 278
Target Start/End: Complemental strand, 19758044 - 19758003
Alignment:
| Q |
237 |
ttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
19758044 |
ttagtccctgcaaatatgcctcattttggttttagtccctgt |
19758003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 269
Target Start/End: Original strand, 20355493 - 20355522
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggtttt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20355493 |
gtccttgcaaatatgtctcgttttggtttt |
20355522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 30709328 - 30709377
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||| |||||||| | |||||||| ||||||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtcc |
30709377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 268
Target Start/End: Complemental strand, 31310678 - 31310633
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttt |
268 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
31310678 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 31503423 - 31503476
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| | || || ||||||||||| ||||||||||||||||||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgt |
31503476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 273
Target Start/End: Complemental strand, 38186742 - 38186709
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
38186742 |
gtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| |||||| | ||||||||| ||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 44841359 - 44841412
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| ||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgt |
44841412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 5355114 - 5355066
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||| ||||| ||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 20355409 - 20355461
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
||||||||||| ||| |||||||||||||| |||||||||||| ||||||| |
|
|
| T |
20355409 |
gctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtccc |
20355461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggtttt |
269 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 246 - 278
Target Start/End: Original strand, 35210206 - 35210238
Alignment:
| Q |
246 |
gcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
35210206 |
gcaaatatgactcgttttggttttagtccctgt |
35210238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 4e-20; HSPs: 189)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 14007490 - 14007575
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14007490 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
14007575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 6567495 - 6567440
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6567495 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
6567440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 7867130 - 7867185
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7867130 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgt |
7867185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 21391097 - 21391152
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21391097 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
21391152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 13260320 - 13260266
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13260320 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 26207280 - 26207334
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt |
26207334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 45290458 - 45290512
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45290458 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 19622656 - 19622709
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19622656 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 225 - 308
Target Start/End: Original strand, 18899842 - 18899925
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaattgtttttggtccctgcaaaa |
18899925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 24649656 - 24649604
Alignment:
| Q |
226 |
aaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
24649604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 1810928 - 1810983
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
1810928 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
1810983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 3247199 - 3247254
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3247199 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
3247254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 3753214 - 3753269
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3753269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 8140435 - 8140490
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8140435 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
8140490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 10631165 - 10631220
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10631165 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
10631220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 11822364 - 11822309
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
11822364 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgt |
11822309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 12360967 - 12360912
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12360967 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
12360912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 13770490 - 13770545
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
13770490 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
13770545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 18302386 - 18302331
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
18302386 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
18302331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 19720713 - 19720768
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19720713 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
19720768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 22919685 - 22919740
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
22919685 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
22919740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 26191733 - 26191682
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26191733 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26191682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 26442564 - 26442615
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26442564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 26442898 - 26442843
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
26442898 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgt |
26442843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 27521577 - 27521632
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
27521632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 29072498 - 29072553
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29072498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29072553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 32626530 - 32626585
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
32626530 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
32626585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 33067349 - 33067400
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33067349 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 34002939 - 34002884
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
34002939 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgt |
34002884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 35308110 - 35308055
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
35308110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
35308055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 39303675 - 39303730
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgt |
39303730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 39747834 - 39747779
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39747834 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
39747779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 45368491 - 45368546
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
45368491 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45368546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 48609237 - 48609292
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48609237 |
gctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgt |
48609292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 48609593 - 48609538
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
48609593 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgt |
48609538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 50428874 - 50428929
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
50428874 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgt |
50428929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 990378 - 990324
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
990378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 4789310 - 4789364
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
4789364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 7001896 - 7001842
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7001896 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 15526361 - 15526307
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15526361 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 18473273 - 18473327
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
18473273 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 24977779 - 24977833
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24977779 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 26061957 - 26062011
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
26061957 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 30322930 - 30322984
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30322930 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 32729048 - 32728994
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
32729048 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 33000668 - 33000614
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33000668 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 35056531 - 35056585
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35056531 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 37545629 - 37545683
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37545629 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 40718111 - 40718165
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40718111 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 41358370 - 41358424
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
41358370 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 41358662 - 41358608
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
41358662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 41881094 - 41881148
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
41881094 |
gctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 45380273 - 45380327
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45380273 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 46868576 - 46868522
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46868576 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 10887597 - 10887544
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10887597 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 18473594 - 18473541
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
18473594 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 18900130 - 18900077
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt |
18900077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 33379889 - 33379942
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
33379889 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 34808200 - 34808253
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgt |
34808253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 44641079 - 44641132
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 49073692 - 49073745
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49073692 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 271
Target Start/End: Complemental strand, 22953555 - 22953507
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttag |
271 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22953555 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 3679627 - 3679682
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
3679627 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
3679682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 3753571 - 3753516
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
3753571 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
3753516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 11822005 - 11822056
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
11822005 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
11822056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 12322969 - 12322914
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
12322969 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgt |
12322914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 12361012 - 12361067
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
12361012 |
gctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgt |
12361067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 13259989 - 13260044
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
13259989 |
gctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgt |
13260044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 21383105 - 21383160
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
21383105 |
gctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt |
21383160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 24507842 - 24507787
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
24507842 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
24507787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 29072861 - 29072806
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
29072861 |
gctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgt |
29072806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 32454293 - 32454238
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
32454293 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgt |
32454238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 33045689 - 33045634
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
33045689 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
33045634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 35005743 - 35005692
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
35005743 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 35307716 - 35307771
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35307716 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
35307771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 38151211 - 38151156
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
38151211 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
38151156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 44157696 - 44157751
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
44157751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 44641431 - 44641376
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
44641431 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
44641376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 48956065 - 48956010
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
48956065 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
48956010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 50429208 - 50429153
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
50429208 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
50429153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 50799131 - 50799186
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
50799131 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
50799186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 52254478 - 52254423
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
52254478 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
52254423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 990089 - 990143
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
990089 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 10631527 - 10631473
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10631527 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 10887234 - 10887288
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10887234 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 19623016 - 19622962
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
19623016 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 24649351 - 24649405
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||| ||||| |
|
|
| T |
24649351 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 24653803 - 24653857
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24653803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 24654166 - 24654112
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
24654166 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 31060788 - 31060842
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
31060788 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 31258340 - 31258394
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
31258340 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 35005445 - 35005499
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
35005445 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 38164294 - 38164240
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38164294 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 45290819 - 45290765
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
45290819 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 47819233 - 47819287
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
47819233 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 47819595 - 47819541
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
47819595 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 29688427 - 29688374
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
29688427 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 307
Target Start/End: Original strand, 52254184 - 52254268
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaa |
307 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
52254184 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaattgtttttggtccctgcaaa |
52254268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 278
Target Start/End: Original strand, 2939934 - 2939985
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| |||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt |
2939985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 3679985 - 3679930
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
3679985 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt |
3679930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 4323829 - 4323884
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||||| |||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgt |
4323884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 4360625 - 4360570
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||| |||||||| |||||| |
|
|
| T |
4360625 |
gctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctgt |
4360570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 7867356 - 7867301
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
7867356 |
gctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgt |
7867301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
15058470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 15211512 - 15211567
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| || |||||||||||||||||||||||||| |||| |
|
|
| T |
15211512 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgt |
15211567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 16060884 - 16060829
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
16060884 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
16060829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 17984334 - 17984389
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| || ||||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
17984334 |
gctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgt |
17984389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 18079399 - 18079454
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| || ||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
18079399 |
gctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgt |
18079454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 239 - 278
Target Start/End: Original strand, 18302070 - 18302109
Alignment:
| Q |
239 |
agtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18302070 |
agtccctgcaaatatgtctcgttttggttttagtccctgt |
18302109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 20948756 - 20948811
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| | |||||||||||||||| ||||||||||||||| |
|
|
| T |
20948756 |
gctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgt |
20948811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 25658015 - 25658070
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
25658015 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgt |
25658070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 26191360 - 26191411
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
26191360 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
26191411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 26324586 - 26324641
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
26324586 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
26324641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 26324946 - 26324891
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
26324946 |
gctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgt |
26324891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 33000306 - 33000361
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
33000306 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgt |
33000361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 33234547 - 33234602
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
33234547 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
33234602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 42482980 - 42483035
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| |||||||||||||| |||| |
|
|
| T |
42482980 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgt |
42483035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 45638893 - 45638846
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||| |
|
|
| T |
45638893 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 8140798 - 8140744
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| || | |||||||||| |||||||||||||||||||||| |
|
|
| T |
8140798 |
gctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 12158691 - 12158745
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
12158691 |
gctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 15211857 - 15211803
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| ||||||||||||| | |||||| |
|
|
| T |
15211857 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 15516583 - 15516637
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
15516583 |
gctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 16026937 - 16026883
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
16026937 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 16083048 - 16083098
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
16083048 |
gctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 270
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 17984700 - 17984650
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
17984700 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 22674204 - 22674254
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||||||||||||||||| |
|
|
| T |
22674204 |
gctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 24507480 - 24507534
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24507480 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 30323292 - 30323238
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
30323292 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 30962417 - 30962471
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||||| || |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
30962417 |
gctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
30962471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 31061150 - 31061096
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
31061150 |
gctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35056893 - 35056839
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35056893 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 38136980 - 38136926
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38136980 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 39747475 - 39747528
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
39747475 |
gctaaaatatggttttggtcct-gcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 45368847 - 45368793
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgt |
45368793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 45380635 - 45380581
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
45380635 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 45638581 - 45638635
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
45638581 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc |
48730565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 48955715 - 48955765
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
48955715 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||| | |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 15211778 - 15211741
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15211778 |
gtccttgcaaatatgtctcgttttggttttggtccctg |
15211741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 15335292 - 15335239
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgt |
15335239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 17130006 - 17129969
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17130006 |
gtccttgcaaatatgtctcgttttggttttggtccctg |
17129969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 20756022 - 20756071
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||| |||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtcc |
20756071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 41739119 - 41739067
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
41739119 |
gctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgt |
41739067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 44158041 - 44157988
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
44158041 |
gctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 26062255 - 26062203
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||| ||||||||||||| |||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctg |
26062203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 32906237 - 32906189
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
32906237 |
taaaatatgattttggtccttgcaaatatgtctcgttttgattttagtc |
32906189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 1159838 - 1159783
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||| ||||||||| || || |||||||||||||||||||| |
|
|
| T |
1159838 |
gctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctgt |
1159783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 4565335 - 4565280
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| | | |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
4565335 |
gctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgt |
4565280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 7819102 - 7819047
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| || |||||||||| |||||||||||||||||| |||| |
|
|
| T |
7819102 |
gctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgt |
7819047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 21383427 - 21383372
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||| |||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
21383427 |
gctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgt |
21383372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 22919976 - 22919925
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||||| |||||||||| |
|
|
| T |
22919976 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc |
22919925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 24978121 - 24978066
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | ||| ||||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
24978121 |
gctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgt |
24978066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 28507457 - 28507402
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | ||| |||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
28507457 |
gctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgt |
28507402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 33045356 - 33045411
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| ||| ||| |||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
33045356 |
gctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgt |
33045411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 33234911 - 33234856
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
33234911 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgt |
33234856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 37624747 - 37624798
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| | |||||| |||||||||| |||||||||||||| |||| |
|
|
| T |
37624747 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 37625026 - 37624971
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| || |||||||| ||||||||||| ||||| |||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtctctgt |
37624971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 41738797 - 41738852
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| |||| |||||||||||||| |
|
|
| T |
41738797 |
gctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgt |
41738852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 224 - 275
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
46183737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 8364915 - 8364861
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| | ||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
8364915 |
gctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 17129691 - 17129745
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| | | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgt |
17129745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 274
Target Start/End: Original strand, 22953258 - 22953308
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||| | |||||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
22953258 |
ctaaaatatagttttagtccatgcaaatatgtctcattttggatttagtcc |
22953308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 29579322 - 29579376
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctgt |
29579376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 248 - 278
Target Start/End: Original strand, 32453956 - 32453986
Alignment:
| Q |
248 |
aaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32453956 |
aaatatgtctcgttttggttttagtccctgt |
32453986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 276
Target Start/End: Original strand, 292868 - 292913
Alignment:
| Q |
231 |
atggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||| ||||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 270
Target Start/End: Complemental strand, 4324163 - 4324118
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
||||||||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
4324163 |
taaaatatgattttagttcatgcaaatatgtctcgttttggtttta |
4324118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 270
Target Start/End: Original strand, 4360299 - 4360343
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| |||||||||||| |
|
|
| T |
4360299 |
taaaatatggttttagtcct-gcaaatatgtcttgttttggtttta |
4360343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 5058989 - 5058936
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| || ||||||| ||||||||| ||||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgt |
5058936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 8364619 - 8364672
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgt |
8364672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 15058765 - 15058716
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||| | ||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
15058765 |
gctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Complemental strand, 18079659 - 18079618
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttg |
264 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |
|
|
| T |
18079659 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 278
Target Start/End: Original strand, 24509965 - 24509998
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
24509965 |
tgcaaatatgtttcgttttggttttagtccctgt |
24509998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 26324869 - 26324832
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
26324869 |
gtccctgcaaatatgtctcgttttggttttcgtccctg |
26324832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 274
Target Start/End: Original strand, 32035459 - 32035488
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32035459 |
tgcaaatatgtctcgttttggttttagtcc |
32035488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 36912854 - 36912895
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttg |
264 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||| |
|
|
| T |
36912854 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||||||||| |||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 39025380 - 39025328
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
39025380 |
gctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 18928141 - 18928089
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtccc |
18928089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 322 - 354
Target Start/End: Complemental strand, 48609494 - 48609462
Alignment:
| Q |
322 |
aaaaatagtctctgactccatttttgtgatgat |
354 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
48609494 |
aaaaatagtctctgaccccatttttgtgatgat |
48609462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 48; Significance: 2e-18; HSPs: 5)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 54816 - 54871
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54816 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
54871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 50000 - 49963
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
50000 |
gtccttgcaaatatgtctcattttggttttggtccctg |
49963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 55101 - 55064
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
55101 |
gtccttgcaaatatgtctcattttggttttggtccctg |
55064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 155)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 14238752 - 14238807
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14238752 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14238807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 29158355 - 29158410
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29158355 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
29158410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 4017299 - 4017245
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4017299 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 8094840 - 8094788
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8094840 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 6146517 - 6146568
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
6146568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 7186003 - 7185948
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7186003 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
7185948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 7272421 - 7272476
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
7272421 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgt |
7272476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 8298588 - 8298643
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8298588 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
8298643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 8298974 - 8298919
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8298974 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
8298919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 9175013 - 9175068
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9175013 |
gctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgt |
9175068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 10337120 - 10337175
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10337120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
10337175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 14239079 - 14239024
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
14239079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14239024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 14489072 - 14489017
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14489072 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
14489017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 16789076 - 16789131
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
16789076 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
16789131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 16789368 - 16789313
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
16789368 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
16789313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 19962996 - 19963051
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19962996 |
gctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgt |
19963051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 22650465 - 22650520
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
22650465 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
22650520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 25131112 - 25131167
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
25131112 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
25131167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 27341590 - 27341535
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
27341590 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27341535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 40492961 - 40493016
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
40492961 |
gctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgt |
40493016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 42133153 - 42133098
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42133153 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
42133098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 43477164 - 43477219
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
43477164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
43477219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 1526171 - 1526117
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1526171 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 1778565 - 1778619
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1778565 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 3512265 - 3512211
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3512265 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 4375693 - 4375778
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
4375693 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaaaaaattgtttttggtccctgcaaaa |
4375778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 7326087 - 7326141
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7326087 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 7420231 - 7420285
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7420231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 8094480 - 8094534
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8094480 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 11019521 - 11019575
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11019521 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 16644043 - 16643989
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
16644043 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 18549571 - 18549517
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgt |
18549517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 19494120 - 19494174
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
19494120 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 19494412 - 19494358
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
19494412 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 22917565 - 22917619
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
22917565 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 24187896 - 24187842
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24187896 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 32725908 - 32725962
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32725908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 34963663 - 34963609
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34963663 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 35097329 - 35097383
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35097329 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 35346630 - 35346684
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35346630 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35346997 - 35346943
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35346997 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Complemental strand, 40066819 - 40066734
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| | ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40066819 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgtaaaaaaaatttgtttttggtccctgcaaaa |
40066734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 40844157 - 40844242
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40844157 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
40844242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 13232201 - 13232254
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
13232254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 24955009 - 24954956
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
24955009 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 40844532 - 40844479
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgt |
40844479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 15719657 - 15719709
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
15719657 |
gctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc |
15719709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 6146948 - 6146893
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
6146893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 6469281 - 6469336
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
6469281 |
gctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgt |
6469336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 7272750 - 7272695
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||| || |||||||||| ||||||||||||||||||||||| |
|
|
| T |
7272750 |
gctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgt |
7272695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 7326420 - 7326365
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
7326420 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
7326365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 10776498 - 10776443
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
10776498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
10776443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 11976374 - 11976429
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
11976374 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
11976429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 14495070 - 14495125
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
14495070 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
14495125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 17073808 - 17073863
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
17073808 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
17073863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 17574462 - 17574407
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
17574462 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
17574407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 20984147 - 20984202
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
20984147 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgt |
20984202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 20984509 - 20984454
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
20984509 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt |
20984454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 25600231 - 25600286
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
25600231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgt |
25600286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 29488109 - 29488054
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29488109 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
29488054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 30969399 - 30969454
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgt |
30969454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 32418319 - 32418370
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
32418319 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32418370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 33526411 - 33526356
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
33526411 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33526356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 1525810 - 1525860
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
1525810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 2728233 - 2728287
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2728233 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 2728596 - 2728542
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
2728596 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 4016906 - 4016960
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 4473705 - 4473759
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
4473705 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 4710219 - 4710165
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
4710219 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 9496342 - 9496396
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
9496342 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 270
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 11019856 - 11019802
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
11019856 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 16643662 - 16643716
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
16643662 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 28346395 - 28346449
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
28346395 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 28346757 - 28346703
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
28346757 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 32726270 - 32726216
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
32726270 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 34963301 - 34963355
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
34963301 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35097691 - 35097637
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35097691 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 37536087 - 37536141
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37536087 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 38930303 - 38930357
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
38930303 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg |
38930357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 42132865 - 42132919
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
42132865 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcct-gcaaatatgtctcgttttggttttagtcc |
43727382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 1685117 - 1685166
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 307
Target Start/End: Complemental strand, 13779531 - 13779447
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaa |
307 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgtaatttttttttgtttttggtccctgcaaa |
13779447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 25131446 - 25131393
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
25131446 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 223 - 271
Target Start/End: Original strand, 1408006 - 1408054
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttag |
271 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
1408006 |
gctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 33636323 - 33636375
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
33636323 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 4474043 - 4473988
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
4474043 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt |
4473988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 4621353 - 4621298
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
4621353 |
gctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
4621298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 7420589 - 7420534
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
7420589 |
gctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgt |
7420534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 10540781 - 10540726
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10540781 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt |
10540726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 10872916 - 10872971
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
10872916 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt |
10872971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 13154887 - 13154942
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | ||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13154887 |
gctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgt |
13154942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 13155250 - 13155195
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || | |||||||||||||||||||||||||| ||||||| |
|
|
| T |
13155250 |
gctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgt |
13155195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 18549202 - 18549257
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
18549202 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgt |
18549257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 20277693 - 20277748
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
20277693 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt |
20277748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 21064320 - 21064375
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
21064320 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt |
21064375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 21125720 - 21125775
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
21125720 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
21125775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 21126020 - 21125965
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
21126020 |
gctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgt |
21125965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 24090487 - 24090432
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgt |
24090432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 24187570 - 24187625
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24187570 |
gctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgt |
24187625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 24815067 - 24815012
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| | || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
24815067 |
gctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgt |
24815012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 25600596 - 25600541
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | ||| |||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
25600596 |
gctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
25600541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 27117754 - 27117809
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
27117754 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgt |
27117809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 28324180 - 28324125
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
28324180 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgt |
28324125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 28399034 - 28398979
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
28399034 |
gctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgt |
28398979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 29158668 - 29158617
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
29158668 |
gctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc |
29158617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 32040076 - 32040131
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
32040076 |
gctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgt |
32040131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 35345616 - 35345561
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
35345616 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgt |
35345561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 40066498 - 40066553
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| |||||||| ||||| |
|
|
| T |
40066498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgt |
40066553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 42430119 - 42430068
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
42430119 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
42430068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 1162910 - 1162964
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
1162910 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 3511907 - 3511961
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
3511907 |
gctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 9496722 - 9496668
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
9496722 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 10337448 - 10337394
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
10337448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 10873279 - 10873225
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10873279 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 13779151 - 13779205
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| ||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgt |
13779205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35143843 - 35143789
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
35143843 |
gctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 37536418 - 37536364
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
37536418 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 38930663 - 38930609
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
38930663 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctg |
38930609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 1408352 - 1408299
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| |||| |||||||||||| |
|
|
| T |
1408352 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct |
1408299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 5357424 - 5357477
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
5357424 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 10755527 - 10755474
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| ||||| ||||| |
|
|
| T |
10755527 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 14496817 - 14496870
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
14496817 |
gctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 28323850 - 28323903
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| | |||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
28323850 |
gctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 28497616 - 28497563
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
28497563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 268
Target Start/End: Complemental strand, 30337216 - 30337171
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttt |
268 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||||||||||||| |
|
|
| T |
30337216 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 277
Target Start/End: Original strand, 4709929 - 4709961
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4709929 |
tgcaaatatgtctcgttttggttttagtccctg |
4709961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 227 - 278
Target Start/End: Original strand, 3680532 - 3680583
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| ||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgt |
3680583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 9832216 - 9832271
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
9832216 |
gctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgt |
9832271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 14488717 - 14488772
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
14488717 |
gctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgt |
14488772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 15930933 - 15930988
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| || | | |||||||||||||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgt |
15930988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 20278056 - 20278005
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
20278056 |
gctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
20278005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 21064683 - 21064632
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
21064683 |
gctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
21064632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 28258240 - 28258189
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||||||||||||||||||| |
|
|
| T |
28258240 |
gctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 29487751 - 29487802
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29487751 |
gctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 33526053 - 33526104
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
33526053 |
gctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| ||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 1163273 - 1163223
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| | |||||| ||||||||| |
|
|
| T |
1163273 |
gctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtc |
1163223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 278
Target Start/End: Complemental strand, 1778911 - 1778873
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
1778911 |
gtccctgcaaatatgtctcgttttggttttaatccctgt |
1778873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 245 - 275
Target Start/End: Complemental strand, 14848167 - 14848137
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14848167 |
tgcaaatatgtctcgttttggttttagtccc |
14848137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 35115638 - 35115584
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| | ||||||| |||||||||||||| ||||||| |
|
|
| T |
35115638 |
gctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 278
Target Start/End: Complemental strand, 2356225 - 2356192
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
2356225 |
tgcaaatatgtctcgttttggttttagtctctgt |
2356192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 9175368 - 9175315
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| || ||||||| |||||||||||||||||| |||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtctctgt |
9175315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 10540450 - 10540503
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| | ||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
10540450 |
gctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 13232561 - 13232512
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||||||||||| |
|
|
| T |
13232561 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 278
Target Start/End: Complemental strand, 13796573 - 13796540
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
13796573 |
tgcaaatatgtctcattttggttttagtccctgt |
13796540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 23939548 - 23939597
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||| |||||||| |
|
|
| T |
23939548 |
gctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 23939625 - 23939662
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
23939625 |
gtccctgcaaatatatctcgttttggttttagtccctg |
23939662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 24090120 - 24090173
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| || |||| | ||||||||||||||| ||||||||||| |
|
|
| T |
24090120 |
gctaaaatatggttttggttcttgtagatatgtctcgttttgattttagtccct |
24090173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 27117975 - 27117922
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| |||||||||| |||||| |
|
|
| T |
27117975 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 267
Target Start/End: Complemental strand, 40493156 - 40493112
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtt |
267 |
Q |
| |
|
|||||||| ||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
40493156 |
gctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 135)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 14428651 - 14428706
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
14428706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 14656259 - 14656204
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14656259 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt |
14656204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 23770162 - 23770217
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
23770217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 25431853 - 25431798
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25431853 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
25431798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 30928682 - 30928737
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30928682 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
30928737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 15962028 - 15962082
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15962028 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 12176640 - 12176587
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
12176587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 225 - 308
Target Start/End: Original strand, 10091039 - 10091122
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
10091122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 10910963 - 10910908
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10910963 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
10910908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 11449168 - 11449113
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
11449168 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgt |
11449113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 15962388 - 15962333
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
15962388 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
15962333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 19690394 - 19690449
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19690394 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
19690449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 21995424 - 21995369
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
21995424 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgt |
21995369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 23502539 - 23502484
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
23502539 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgt |
23502484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 33131849 - 33131794
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33131849 |
gctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgt |
33131794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 34582530 - 34582585
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
34582530 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
34582585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 3968646 - 3968700
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3968646 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 6412219 - 6412273
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6412219 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 7156159 - 7156105
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7156159 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 15076203 - 15076149
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
15076203 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 21385252 - 21385306
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21385252 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 22543717 - 22543663
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22543717 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 24274130 - 24274076
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24274130 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 24692978 - 24692924
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
24692978 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 33801742 - 33801688
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
33801742 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 26376042 - 26375989
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
26375989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 11448538 - 11448590
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11448538 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc |
11448590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 317813 - 317868
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
317813 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgt |
317868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 318096 - 318041
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
318096 |
gctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgt |
318041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 494406 - 494457
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
494406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
494457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 226 - 277
Target Start/End: Original strand, 543365 - 543416
Alignment:
| Q |
226 |
aaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 1007508 - 1007453
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
1007508 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
1007453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 3276353 - 3276302
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
3276353 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3276302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 225 - 276
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 3414388 - 3414443
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3414388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
3414443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 3969008 - 3968953
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3969008 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
3968953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 9896636 - 9896585
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
9896636 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 12757611 - 12757666
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
12757611 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgt |
12757666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 18024374 - 18024319
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
18024374 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
18024319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 19296406 - 19296351
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
19296406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
19296351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 21993788 - 21993843
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21993788 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgt |
21993843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 21995065 - 21995120
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
21995065 |
gctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgt |
21995120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 25137356 - 25137301
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
25137356 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
25137301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 26375694 - 26375749
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
26375694 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgt |
26375749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 30929043 - 30928988
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
30929043 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30928988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 34582891 - 34582836
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
34582891 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgt |
34582836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 1890451 - 1890397
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
1890451 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 2615873 - 2615958
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
2615873 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctataaaaaaaaattgtttttggtccctgcaaaa |
2615958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 3414751 - 3414697
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
3414751 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 7155798 - 7155852
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| | |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7155798 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 8170150 - 8170100
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
8170150 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 8680776 - 8680830
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8680776 |
gctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 8681115 - 8681061
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
8681115 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 12419937 - 12419883
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
12419937 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 13617531 - 13617585
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgt |
13617585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc |
14428898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 14655380 - 14655434
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
14655380 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 19129337 - 19129391
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
19129337 |
gctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 21994402 - 21994348
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
21994402 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 22543355 - 22543409
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
22543355 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 22822650 - 22822596
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
22822650 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 24901240 - 24901290
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
24901240 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 31167199 - 31167145
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
31167199 |
gctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 31198616 - 31198670
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
31198616 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 32885674 - 32885728
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
32885674 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 237 - 278
Target Start/End: Original strand, 7323883 - 7323924
Alignment:
| Q |
237 |
ttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7323883 |
ttagcccttgcaaatatgtctcgttttggttttagtccctgt |
7323924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 7324189 - 7324136
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
7324136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 308
Target Start/End: Original strand, 9896280 - 9896364
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||| |||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
9896364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 17765010 - 17765059
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
17765010 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 18024014 - 18024067
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgt |
18024067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 30239294 - 30239347
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
30239294 |
gctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 34990312 - 34990259
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
34990259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 22792898 - 22792846
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| | |||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
22792898 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 1007125 - 1007180
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1007125 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt |
1007180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 2373180 - 2373235
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || ||||||||| |||||||||| |
|
|
| T |
2373180 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgt |
2373235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 3356143 - 3356194
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
3356143 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3356194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 6468311 - 6468366
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
6468311 |
gctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt |
6468366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 10910630 - 10910685
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
10910630 |
gctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgt |
10910685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 12299139 - 12299084
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
12299139 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt |
12299084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 12419709 - 12419760
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
12419709 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 12612358 - 12612303
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
12612358 |
gctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgt |
12612303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 13150749 - 13150694
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
13150749 |
gctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgt |
13150694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 15722611 - 15722666
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
15722611 |
gctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgt |
15722666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 17771912 - 17771963
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
17771912 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
17771963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 19129519 - 19129464
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
19129519 |
gctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgt |
19129464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 21147405 - 21147460
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
21147405 |
gctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgt |
21147460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 25121495 - 25121440
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
25121495 |
gctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgt |
25121440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 25136995 - 25137050
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
25136995 |
gctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgt |
25137050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 30479421 - 30479366
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgt |
30479366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 31398540 - 31398489
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31398540 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc |
31398489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 6412578 - 6412524
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
6412578 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 12176386 - 12176471
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| ||||| || || |||||||||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
12176386 |
gctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtccatgtaaaaaaaaattgtttttggtccctgcaaaa |
12176471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 19320769 - 19320823
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgt |
19320823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 20467717 - 20467663
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
20467717 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 21385583 - 21385529
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
21385583 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 24273829 - 24273883
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
24273829 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 33808621 - 33808675
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| ||||||||| |||||||||||| |
|
|
| T |
33808621 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 1214995 - 1214942
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
1214995 |
gctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 13268110 - 13268163
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
13268110 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct |
13268163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 19321130 - 19321081
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
19321130 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 1890062 - 1890114
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| |||||||| || ||||||| ||||||||| |||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 276
Target Start/End: Original strand, 6564600 - 6564636
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6564600 |
gtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||| | ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 6564942 - 6564888
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| ||| ||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
6564942 |
gctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
6564888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 14655904 - 14655959
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||| |||| ||| |||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
14655904 |
gctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgt |
14655959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 17765374 - 17765319
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
17765374 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgt |
17765319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 19267566 - 19267621
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
19267566 |
gctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgt |
19267621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 19296109 - 19296164
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||| |||| |||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
19296109 |
gctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgt |
19296164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 23628799 - 23628854
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||| | ||||||||||||||||| |||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcactgt |
23628854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 31186590 - 31186535
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || | |||||||||| |||||||| |||||||||||||| |
|
|
| T |
31186590 |
gctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgt |
31186535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 31276339 - 31276284
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| | ||| |||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgt |
31276284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 777678 - 777732
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
777678 |
gctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg |
777732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Complemental strand, 2616239 - 2616193
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttt |
269 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || ||||||||||| |
|
|
| T |
2616239 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Original strand, 6591116 - 6591162
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttt |
269 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
6591116 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 278
Target Start/End: Complemental strand, 13617798 - 13617760
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
13617798 |
gtccctgcaaatatgcctcgttttggttttagtccctgt |
13617760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Original strand, 23502238 - 23502284
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttt |
269 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||| |
|
|
| T |
23502238 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 25121185 - 25121234
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
25121185 |
gctaaaatatggttttcatcct-gcaaatatgtctcgttttggttttagtc |
25121234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 778041 - 777992
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||| |||||||| |
|
|
| T |
778041 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 1214697 - 1214750
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| | ||| |||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
1214697 |
gctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 1214772 - 1214809
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
1214772 |
gtccctgcaaatatgtcttgttttggttttagtccctg |
1214809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 12298896 - 12298933
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
12298896 |
gtccatgcaaatatgtctcgttttggttttggtccctg |
12298933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 13268187 - 13268224
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
13268187 |
gtccctgcaaatatgtctcgttttggttttggtccctg |
13268224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 19129442 - 19129405
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
19129442 |
gtccctgcaaatatgtctcgttttggttttggtccctg |
19129405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 273
Target Start/End: Complemental strand, 19275218 - 19275185
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
19275218 |
gtccctgcaaatatgtctcgttttggttttagtc |
19275185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 269
Target Start/End: Original strand, 19690472 - 19690501
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggtttt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19690472 |
gtccttgcaaatatgtctcgttttggtttt |
19690501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 22822308 - 22822357
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
22822308 |
gctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 19690755 - 19690708
Alignment:
| Q |
226 |
aaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtcc |
19690708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 263
Target Start/End: Complemental strand, 23770438 - 23770398
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgtttt |
263 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
23770438 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 267
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtt |
267 |
Q |
| |
|
|||||||||||| |||||||| | |||||||||||| |||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 199)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 22008527 - 22008582
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22008527 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
22008582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 22016045 - 22016100
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22016045 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
22016100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 53701662 - 53701607
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
53701662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
53701607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 39436719 - 39436773
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39436719 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 223 - 307
Target Start/End: Original strand, 4513264 - 4513348
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaa |
307 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4513264 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaa |
4513348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 43440496 - 43440549
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43440496 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 4034718 - 4034773
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4034718 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
4034773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 4513619 - 4513564
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4513619 |
gctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgt |
4513564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 4950038 - 4950093
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
4950038 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
4950093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 12741270 - 12741215
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12741270 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
12741215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 25710869 - 25710814
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
25710869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
25710814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 26090077 - 26090022
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26090077 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
26090022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 30034471 - 30034416
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30034471 |
gctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgt |
30034416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 30130159 - 30130214
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
30130159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
30130214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 31869955 - 31869900
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
31869955 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt |
31869900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 34238599 - 34238650
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34238599 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 46186770 - 46186715
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
46186770 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgt |
46186715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 47336580 - 47336525
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47336580 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
47336525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 51550445 - 51550390
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51550445 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
51550390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 54608862 - 54608807
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54608862 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
54608807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 474045 - 474099
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
474045 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 3152110 - 3152056
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
3152110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Complemental strand, 4814897 - 4814813
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
4814897 |
gctaaaatatggttttagtcct-gcaaatatgtctcgttttggttttagtccctataaaaaaaaattgtttttggtccctgcaaaa |
4814813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 10976979 - 10977033
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10976979 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 12740908 - 12740962
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12740908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 15016389 - 15016474
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15016389 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtgaaaaaaaattgtttttggtccctgcaaaa |
15016474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 20612897 - 20612843
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
20612897 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 22155930 - 22155984
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
22155930 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 28427246 - 28427300
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
28427246 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 28427607 - 28427553
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
28427607 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 30552477 - 30552423
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30552477 |
gctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 37506868 - 37506922
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37506868 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 37507221 - 37507167
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37507221 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 39288574 - 39288624
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39288574 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 39437108 - 39437054
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
39437108 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 40169653 - 40169599
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
40169653 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 46622128 - 46622074
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46622128 |
gctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 50196301 - 50196355
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
50196355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 51834609 - 51834663
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
51834609 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 1721092 - 1721145
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgt |
1721145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 3151751 - 3151804
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
3151751 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 35569133 - 35569080
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
35569080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 3830135 - 3830190
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
3830135 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
3830190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 3830515 - 3830464
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3830515 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3830464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 270
Target Start/End: Original strand, 4814541 - 4814588
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
4814541 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 5345688 - 5345633
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
5345688 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
5345633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 9863403 - 9863348
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9863403 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
9863348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 15979700 - 15979645
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
15979700 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt |
15979645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 16123140 - 16123195
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
16123140 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
16123195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 21159454 - 21159505
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
21159454 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
21159505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 21159816 - 21159761
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
21159816 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
21159761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 25615976 - 25616031
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
25615976 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
25616031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 278
Target Start/End: Original strand, 25710515 - 25710566
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
25710515 |
aaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
25710566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 28452148 - 28452199
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
28452148 |
gctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc |
28452199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 29445955 - 29446010
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29445955 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29446010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 29446205 - 29446154
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
29446205 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
29446154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 29490742 - 29490687
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
29490742 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
29490687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 29525106 - 29525157
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
29525106 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 30268506 - 30268561
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
30268506 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30268561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 31480137 - 31480192
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
31480137 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
31480192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 45320978 - 45320923
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
45320978 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45320923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 47005155 - 47005210
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
47005155 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgt |
47005210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 49323783 - 49323838
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
49323783 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
49323838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 51759820 - 51759875
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| | |||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
51759820 |
gctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgt |
51759875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 474407 - 474353
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
474407 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 8510215 - 8510269
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
8510215 |
gctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 10977340 - 10977286
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10977340 |
gctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg |
10977286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 13584366 - 13584312
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
13584366 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 14633888 - 14633834
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||| ||||| |||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
14633888 |
gctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
14633834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 22008889 - 22008835
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
22008889 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 26799889 - 26799943
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
26799889 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 28552382 - 28552328
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
28552382 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 28942904 - 28942850
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
28942904 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 29955300 - 29955354
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
29955354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 30004454 - 30004508
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
30004508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 31480499 - 31480445
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
31480499 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 31869596 - 31869650
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||| | | |||||||||||||||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgt |
31869650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 39288897 - 39288843
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
39288897 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 40169345 - 40169399
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
40169345 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 43441271 - 43441325
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
43441271 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 51500684 - 51500630
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| | |||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
51500684 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 51550083 - 51550137
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
51550083 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 51834941 - 51834887
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
51834941 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 54608519 - 54608573
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
54608519 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 277
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
| Q |
228 |
aatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
8510474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 14633547 - 14633600
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||| ||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctg |
14633600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 45161116 - 45161169
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| || ||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgt |
45161169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 45521833 - 45521780
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt |
45521780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 9262154 - 9262102
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
9262154 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 40370588 - 40370536
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
40370588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 1721451 - 1721396
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1721451 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt |
1721396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 9261790 - 9261845
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9261790 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
9261845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 11463233 - 11463288
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| || | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgt |
11463288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 12673645 - 12673700
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
12673645 |
gctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
12673700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 18175792 - 18175875
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
18175792 |
gctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctgtaaaaaaaaattgtttttggtccctgcaaaa |
18175875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 19656542 - 19656593
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
19656542 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc |
19656593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 19844580 - 19844525
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
19844580 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
19844525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 20757403 - 20757454
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct |
20757454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 28552022 - 28552077
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
28552022 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgt |
28552077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 29678025 - 29678080
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | ||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29678025 |
gctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgt |
29678080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 29686545 - 29686600
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||| ||||||| ||| |||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
29686545 |
gctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgt |
29686600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 29955661 - 29955610
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
29955661 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
29955610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 30004816 - 30004765
Alignment:
| Q |
227 |
aaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30004816 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
30004765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 30106219 - 30106164
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
30106219 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt |
30106164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 30128285 - 30128340
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||| ||||||||||||||||||||| ||||| |
|
|
| T |
30128285 |
gctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgt |
30128340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 30424629 - 30424684
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
30424629 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctctgt |
30424684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 40545565 - 40545620
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
40545565 |
gctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt |
40545620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 40979709 - 40979654
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
40979709 |
gctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgt |
40979654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 44802283 - 44802338
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||| ||||| |
|
|
| T |
44802283 |
gctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgt |
44802338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 45002384 - 45002329
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
45002384 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgt |
45002329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 46751272 - 46751323
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
46751272 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
46751323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 48924239 - 48924184
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
48924239 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgt |
48924184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 50196656 - 50196601
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| |||||||| |||||||||||||| |
|
|
| T |
50196656 |
gctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgt |
50196601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 275445 - 275499
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||| |||| ||||||||| |||||||||||| |
|
|
| T |
275445 |
gctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 15979339 - 15979393
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
15979339 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 20611021 - 20611071
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
20611021 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 26089731 - 26089785
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
26089731 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 32119221 - 32119275
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| | ||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
32119221 |
gctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 32119583 - 32119529
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
32119583 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 34582525 - 34582579
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||||| || |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
34582525 |
gctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
34582579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 43441602 - 43441548
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
43441602 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 45002022 - 45002076
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
45002022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 45006247 - 45006193
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| | |||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
45006193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 47114488 - 47114538
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
47114488 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 47336229 - 47336283
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
47336229 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 863649 - 863596
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||| |||||||| ||||||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgt |
863596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 4322186 - 4322133
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||| | ||| |||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
4322133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 9603630 - 9603683
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
9603630 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 28942526 - 28942575
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || |||||||||||||| |
|
|
| T |
28942526 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 35177256 - 35177305
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
35177256 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 40545836 - 40545783
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| ||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgt |
40545783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 46901105 - 46901154
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
46901105 |
gctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 14772212 - 14772264
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
14772212 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 30426225 - 30426174
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccc |
275 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
30426225 |
gctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 49670477 - 49670529
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||| ||||||||||||||||||| || |||||||||||| |||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctg |
49670529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 271
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttag |
271 |
Q |
| |
|
|||||||||||| | |||||| |||||||||| |||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 863282 - 863337
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
863282 |
gctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgt |
863337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 3387603 - 3387552
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3387603 |
gctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 4035052 - 4034997
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| |||||||| ||||| |
|
|
| T |
4035052 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgt |
4034997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 4321947 - 4322002
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| | | |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
4321947 |
gctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctgt |
4322002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 7518091 - 7518142
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||||| |||||||||| |
|
|
| T |
7518091 |
gctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc |
7518142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 7957225 - 7957170
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7957225 |
gctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgt |
7957170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 9596759 - 9596814
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgt |
9596814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 9597094 - 9597039
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
9597094 |
gctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgt |
9597039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 9863050 - 9863100
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| |||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct |
9863100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 13514576 - 13514525
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| ||| || | |||||||||||||||||||||||||||||| |
|
|
| T |
13514576 |
gctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc |
13514525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 20644506 - 20644561
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | ||| |||| |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
20644506 |
gctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgt |
20644561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 21553890 - 21553945
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| ||||||| |||||| |
|
|
| T |
21553890 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgt |
21553945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 25609768 - 25609823
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| || |||||| | ||||||||||||||||||||||| |
|
|
| T |
25609768 |
gctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgt |
25609823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 25610129 - 25610078
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
25610078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 28418899 - 28418844
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||| | |||||| ||||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgt |
28418844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 30552150 - 30552200
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||| |||||||||||||||||| |
|
|
| T |
30552150 |
taaaatatggttttagacct-gcaaatatgtcttgttttggttttagtccct |
30552200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 34238914 - 34238863
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
34238914 |
gctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 35407789 - 35407734
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
35407789 |
gctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgt |
35407734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 35498417 - 35498472
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| |||||||||||||| ||||||| |
|
|
| T |
35498417 |
gctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctgt |
35498472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 35565509 - 35565564
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
35565509 |
gctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgt |
35565564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 38232242 - 38232293
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
38232242 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc |
38232293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 39072212 - 39072157
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
39072212 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgt |
39072157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 40370286 - 40370341
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
40370286 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgt |
40370341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 45313862 - 45313807
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
45313862 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgt |
45313807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
46186461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 47005518 - 47005467
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
47005518 |
gctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc |
47005467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 49670802 - 49670747
Alignment:
| Q |
223 |
gctaaaatatggctttagtcct-tgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
49670802 |
gctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 50009283 - 50009228
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
50009283 |
gctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgt |
50009228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 50261935 - 50261880
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||| || |||||||||||||| |||| |
|
|
| T |
50261935 |
gctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtctctgt |
50261880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 52342582 - 52342531
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
52342582 |
gctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc |
52342531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 11312567 - 11312513
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||||| || |||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
11312567 |
gctaaaatatggcattggtccatgcaaatatgttcagttttggttttagtccctg |
11312513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 14772523 - 14772469
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||| | ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctgt |
14772469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 15286157 - 15286207
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
15286157 |
gctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 19297947 - 19297893
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||| | ||| ||||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
19297947 |
ctaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtctctgt |
19297893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 248 - 278
Target Start/End: Original strand, 20907163 - 20907193
Alignment:
| Q |
248 |
aaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20907163 |
aaatatgtctcgttttggttttagtccctgt |
20907193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 28452375 - 28452321
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
28452375 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 270
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 236 - 274
Target Start/End: Complemental strand, 43440773 - 43440735
Alignment:
| Q |
236 |
tttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
43440773 |
tttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 46724545 - 46724599
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
46724545 |
ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctgt |
46724599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Original strand, 53113444 - 53113490
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttt |
269 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||| |||| |
|
|
| T |
53113444 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 7957149 - 7957112
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
7957149 |
gtccctgcaaatatgtctcgttttggttttggtccctg |
7957112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 8555305 - 8555256
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc |
8555256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 20907454 - 20907401
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| ||| |||||||||||||| |||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgt |
20907401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 25610053 - 25610016
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
25610053 |
gtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 36672966 - 36673019
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||| ||||||||||||||| |||| |
|
|
| T |
36672966 |
taaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgt |
36673019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 278
Target Start/End: Original strand, 39132565 - 39132598
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
39132565 |
tgcaaatatgtttcgttttggttttagtccctgt |
39132598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 39132829 - 39132792
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
39132829 |
gtccctgcaaatatgtctcgttttggttttggtccctg |
39132792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 40279334 - 40279285
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
40279334 |
gctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagt |
40279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 54767524 - 54767471
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgt |
54767471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 224 - 272
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| ||| ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 245 - 277
Target Start/End: Original strand, 20644588 - 20644620
Alignment:
| Q |
245 |
tgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
20644588 |
tgcaaatatgtctcgttttggttttggtccctg |
20644620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 236 - 276
Target Start/End: Complemental strand, 28452302 - 28452262
Alignment:
| Q |
236 |
tttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| |||||| |
|
|
| T |
28452302 |
tttagtccctgcaaatatgtctcattttggttttggtccct |
28452262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 276
Target Start/End: Complemental strand, 29490665 - 29490629
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
29490665 |
gtccttgcaaatatatctcgttttggttttggtccct |
29490629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 241 - 277
Target Start/End: Complemental strand, 48924162 - 48924126
Alignment:
| Q |
241 |
tccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
48924162 |
tccttgcaaatatgtctcgtttgggttttggtccctg |
48924126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 2779 - 2864
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaaa |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2779 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaa |
2864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 1312 - 1366
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1312 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 1643 - 1589
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1643 |
gctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg |
1589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 288 - 234
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
288 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 223 - 307
Target Start/End: Original strand, 3533 - 3617
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttgtttttggtccctgcaaa |
307 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
3533 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaattgtttttggtccctgcaaa |
3617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 3917 - 3862
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
3917 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
3862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 9027 - 8972
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9027 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
8972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 8734 - 8788
Alignment:
| Q |
224 |
ctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
8788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 12526 - 12577
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12526 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
12577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 44; Significance: 6e-16; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 4042 - 4093
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4042 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 19224 - 19275
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19224 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 4287 - 4236
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
4287 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
4236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 19469 - 19418
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19469 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
19418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 14698 - 14753
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
14698 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 15011 - 14956
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
15011 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt |
14956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 3290 - 3235
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3290 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
3235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 24373 - 24428
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24373 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 27363 - 27308
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27363 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
27308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 365980 - 366035
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
365980 |
gctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgt |
366035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 366272 - 366217
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
366272 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
366217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 148281 - 148226
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
148281 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
148226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 5707 - 5653
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
5707 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 5400 - 5450
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
5400 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 47926 - 47980
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47926 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 223171 - 223120
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
223171 |
gctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 48228 - 48175
Alignment:
| Q |
225 |
taaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||| ||| |||| |||||||||| ||| |||||||||||||| |||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgt |
48175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 276
Target Start/End: Original strand, 222889 - 222925
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
222889 |
gtccctgcaaatatgtctcgttttggttttggtccct |
222925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 5210 - 5265
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
5210 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgt |
5265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 5230 - 5285
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
5230 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgt |
5285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 8331 - 8382
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
8331 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 8641 - 8590
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
8641 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 82705 - 82650
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
82705 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
82650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 82342 - 82396
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
82342 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 75360 - 75415
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
75360 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgt |
75415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 75763 - 75709
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
75763 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 12183 - 12238
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
12183 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgt |
12238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 12535 - 12484
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
12535 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
12484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 10514 - 10459
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||||||||||||| ||||| |
|
|
| T |
10514 |
gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt |
10459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 10169 - 10220
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
10169 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 8548 - 8602
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8548 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 34932 - 34986
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
34932 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 4311 - 4260
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtcc |
274 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||| ||||| |
|
|
| T |
4311 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtcc |
4260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 277
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
229 |
atatggctttagtccttgcaaatatgtctcgttttggttttagtccctg |
277 |
Q |
| |
|
|||||| |||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 18042 - 17987
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||| |||||||||| |||||||||||| |
|
|
| T |
18042 |
gctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgt |
17987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 16725 - 16780
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
||||||||||| ||| |||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
16725 |
gctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgt |
16780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 17965 - 17910
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
17965 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt |
17910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 35083 - 35028
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| ||| ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
35083 |
gctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgt |
35028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 94058 - 94113
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccctgt |
278 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||||||||||||||| ||||||| |
|
|
| T |
94058 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgt |
94113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggtttta |
270 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 2659 - 2606
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
2659 |
gctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 3454 - 3405
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagt |
272 |
Q |
| |
|
|||||||||| | |||||| | |||||||||||||||||||||||||||| |
|
|
| T |
3454 |
gctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 2882 - 2829
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||| |||||||||| |
|
|
| T |
2882 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 4078 - 4028
Alignment:
| Q |
223 |
gctaaaatatggctttagtccttgcaaatatgtctcgttttggttttagtc |
273 |
Q |
| |
|
||||||||| || ||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
4078 |
gctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 276
Target Start/End: Original strand, 21768 - 21804
Alignment:
| Q |
240 |
gtccttgcaaatatgtctcgttttggttttagtccct |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
21768 |
gtccctgcaaatatgtctcgttttggttttggtccct |
21804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University