View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5151_high_3 (Length: 238)
Name: NF5151_high_3
Description: NF5151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5151_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 36540213 - 36540442
Alignment:
| Q |
1 |
ttcgactacttcatcagtttgtagtacagacttatcatgtgtgtcttctgaggctgaggaagagacaagtgctatggttctcctaggttgtcctcaatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36540213 |
ttcgactacttcatcagtttgtagtacggacttatcatgtgtgtcttctgaggctgaagaagagacaagtgctatggttctcctaggttgtcttcaatgt |
36540312 |
T |
|
| Q |
101 |
cacatgtatgttttgttatccgaggctgatcccaatccaaaatgtcctaagtgtaagagtactgtcttgcttgatttccttaacaacaaacaaaatacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36540313 |
cacatgtatgttttgttatccgaggctgatcccaatccaaaatgccctaagtgtaagagtactgtcttgcttgatttccttaacaacaaacaaaatacca |
36540412 |
T |
|
| Q |
201 |
gaaaaacaagcagctagcaagatgatgatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36540413 |
gaaaaacaagcagctagcaagatgatgatg |
36540442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 185
Target Start/End: Complemental strand, 18904119 - 18904069
Alignment:
| Q |
135 |
atccaaaatgtcctaagtgtaagagtactgtcttgcttgatttccttaaca |
185 |
Q |
| |
|
|||| |||||||| ||||| ||||||||||| ||||||||||| ||||||| |
|
|
| T |
18904119 |
atcccaaatgtcccaagtgcaagagtactgtgttgcttgattttcttaaca |
18904069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University