View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5151_high_5 (Length: 219)
Name: NF5151_high_5
Description: NF5151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5151_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 36540197 - 36539995
Alignment:
| Q |
1 |
gctgacgatgatgagtttatagaccgtcggttgaagtgtatcggcggttctgattctaagatatgcctaagaactttctaaaatggttgcaatgaaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36540197 |
gctgacgatgatgagtttatagaccgtcggttgaagtgtatcggcggttctgattctaagatatgcctaagaactttctaaaatggttgcaatgaaagga |
36540098 |
T |
 |
| Q |
101 |
agtaaaatatctaggattatgattatgttagtggtttatgttatgtggagcaaatagggtcattatatatattgtgcaattgaagagaaaggaacagagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36540097 |
agtaaaatatctaggattatgattatgttagtggtttatgttatgtggagcaaatagggtcattatatatattgtgcaattgaagagaaaggaacagagg |
36539998 |
T |
 |
| Q |
201 |
agg |
203 |
Q |
| |
|
||| |
|
|
| T |
36539997 |
agg |
36539995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University