View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5151_low_2 (Length: 247)
Name: NF5151_low_2
Description: NF5151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5151_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 9338597 - 9338377
Alignment:
| Q |
18 |
ttcgacaaagtccccgtttggttttagtcgttctagattctttattgctttgataagcaacccttcttcgtctttgttgattagccttgtttcgcttcca |
117 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9338597 |
ttcgacaaagtccccgtctggttctagtcgttctagattctttattgctttgataagcagcccttcgtcgtctttgttgattagccttgtttcgcttcca |
9338498 |
T |
 |
| Q |
118 |
acatcgagttcgactataatcatctcttcaggggttgatgctcgccacgctcggtcccgcgtgaagcctgccttgacatagattattttgatgatgtaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9338497 |
acatcgagttcgactataatcatctcttcaggggttgatgctcgatacgctcggttctgcgtgaagcctgccttgacatagattattttgatgatgtaat |
9338398 |
T |
 |
| Q |
218 |
cttaggttgttttgatgatgt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9338397 |
cttaggttgttttgatgatgt |
9338377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 214
Target Start/End: Complemental strand, 11354632 - 11354597
Alignment:
| Q |
179 |
tgaagcctgccttgacatagattattttgatgatgt |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11354632 |
tgaagcctgccttgacataggttattttgatgatgt |
11354597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University