View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5152-Insertion-3 (Length: 510)
Name: NF5152-Insertion-3
Description: NF5152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5152-Insertion-3 |
 | |
|
| [»] scaffold0119 (2 HSPs) |
| | |
|
| [»] scaffold0011 (4 HSPs) |
| | |
|
| [»] scaffold0005 (6 HSPs) |
| | |
|
| [»] scaffold0684 (3 HSPs) |
| | |
|
| [»] scaffold0176 (4 HSPs) |
| | |
|
| [»] scaffold0085 (3 HSPs) |
| | |
|
| [»] scaffold0024 (3 HSPs) |
| | |
|
| [»] scaffold0007 (3 HSPs) |
| | |
|
| [»] scaffold0026 (3 HSPs) |
| | |
|
| [»] scaffold0001 (3 HSPs) |
| | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
| [»] scaffold0160 (4 HSPs) |
| | |
|
| [»] scaffold1001 (1 HSPs) |
| | |
|
| [»] scaffold0056 (5 HSPs) |
| | |
|
| [»] scaffold0003 (3 HSPs) |
| | |
|
| [»] scaffold0535 (2 HSPs) |
| | |
|
| [»] scaffold0210 (2 HSPs) |
| | |
|
| [»] scaffold0078 (3 HSPs) |
| | |
|
| [»] scaffold0326 (4 HSPs) |
| | |
|
| [»] scaffold0712 (1 HSPs) |
| | |
|
| [»] scaffold0709 (1 HSPs) |
| | |
|
| [»] scaffold0065 (3 HSPs) |
| | |
|
| [»] scaffold0021 (2 HSPs) |
| | |
|
| [»] scaffold0811 (2 HSPs) |
| | |
|
| [»] scaffold0373 (1 HSPs) |
| | |
|
| [»] scaffold0370 (1 HSPs) |
| | |
|
| [»] scaffold0002 (2 HSPs) |
| | |
|
| [»] scaffold0166 (1 HSPs) |
| | |
|
| [»] scaffold0159 (1 HSPs) |
| | |
|
| [»] scaffold0123 (1 HSPs) |
| | |
|
| [»] scaffold0347 (2 HSPs) |
| | |
|
| [»] scaffold0337 (1 HSPs) |
| | |
|
| [»] scaffold0060 (2 HSPs) |
| | |
|
| [»] scaffold0051 (2 HSPs) |
| | |
|
| [»] scaffold0016 (2 HSPs) |
| | |
|
| [»] scaffold0105 (2 HSPs) |
| | |
|
| [»] scaffold0472 (2 HSPs) |
| | |
|
| [»] scaffold0106 (1 HSPs) |
| | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
| [»] scaffold0578 (1 HSPs) |
| | |
|
| [»] scaffold0291 (1 HSPs) |
| | |
|
| [»] scaffold0032 (1 HSPs) |
| | |
|
| [»] scaffold0339 (1 HSPs) |
| | |
|
| [»] scaffold0562 (1 HSPs) |
| | |
|
| [»] scaffold0428 (1 HSPs) |
| | |
|
| [»] scaffold0204 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 2e-65; HSPs: 201)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 8 - 196
Target Start/End: Complemental strand, 15443506 - 15443326
Alignment:
| Q |
8 |
atatctggtgatgaaattttaaacaatggaaaacctgacaacaactgtagtttttatgttgatattgtcgttgtctgttcatgttttaatttgtatatgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15443506 |
atatctggtgatgaaattttaaacaatggaaaacctgacaacaactgtggtttttatgttgatattgtcgttgtctgttcatgttttaatttgtatatgt |
15443407 |
T |
|
| Q |
108 |
tggagattgagttgtgttttatagttgttagttatcataaataactgttgtggtttgccaacttgcatggttgcatatatgtcctttgt |
196 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||| ||||| |||||| ||||| ||||||||| |||||| |
|
|
| T |
15443406 |
tggagattgagttgtgttttatagtt----gttatc----ataactgttgtgatttgcgaacttgtatggtatcatatatgttctttgt |
15443326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 23628937 - 23629032
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| ||| ||| |||||||| |
|
|
| T |
23628937 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacgtgtacaaatcat |
23629032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 390 - 483
Target Start/End: Complemental strand, 19690618 - 19690525
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||| ||| |||||||||||| |
|
|
| T |
19690618 |
ttttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagccatcatgtgccacgtgtgcaaatcat |
19690525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 8169928 - 8170023
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||| ||||||||||||||| |||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
8169928 |
tattttgcagggaccattttaaaaatcaaaagattttacagggactatttttctaataaatgagttcagtcatcatgtgtcacgtgtgcaaatcat |
8170023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 23502402 - 23502307
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||| ||||||||||||| ||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
23502402 |
tattttgcaaggaccattttaaaaatcaaaagattttgaagggactattttttcaataaatgggttcagtcatcatgtgccacatgtgcaaatcat |
23502307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 401 - 483
Target Start/End: Complemental strand, 18024222 - 18024140
Alignment:
| Q |
401 |
cctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| | ||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
18024222 |
cctttttaaaaatcaaaagattttgtagggactattttcctaataaatggattcaagcatcatgtgccacatgtgcaaatcat |
18024140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 3414527 - 3414619
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||||| || |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
3414527 |
tattttacagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacatgtgcaaat |
3414619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 25121273 - 25121367
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||| |||||||||||| |
|
|
| T |
25121273 |
tattttgcagagacttttttaaaaatcaaaagattttgcagggactatttttctaataaatgg-gtcagtcatcatgtgtcacgtgtgcaaatcat |
25121367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 31198840 - 31198745
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
31198840 |
tattttgcagggaccttttttaaaatcaaaatattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
31198745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 388 - 482
Target Start/End: Complemental strand, 15443189 - 15443095
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatca |
482 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||| || |||||||||||||||||||| | |||||||||||||||||| |||||| |||| |
|
|
| T |
15443189 |
tattttgcaggaacctttttaaaaatcaaaagattttacatggactatttttcaaataaataggttcaatcatcatgtgtcatgtgtgcagatca |
15443095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 262 - 327
Target Start/End: Complemental strand, 3969015 - 3968950
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3969015 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
3968950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 388 - 485
Target Start/End: Original strand, 6564720 - 6564817
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataa |
485 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||| ||||||||| || |||||||||||||| |
|
|
| T |
6564720 |
tattttgtagggacctttttaaaaatcaaaagattttgcagtgactatttttctaataaatgggttcagtcatcatgttccatgtgtgcaaatcataa |
6564817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 401 - 478
Target Start/End: Original strand, 12757725 - 12757802
Alignment:
| Q |
401 |
cctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaa |
478 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
12757725 |
cctttttaaaaatcaaaaaattttgcagggactatttttctaatagatgggttcagtcatcatgtgtcacatgtgcaa |
12757802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 390 - 483
Target Start/End: Complemental strand, 13617752 - 13617659
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| | |||||||| ||| |||||||||||| |
|
|
| T |
13617752 |
ttttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagttatcatgtgccacgtgtgcaaatcat |
13617659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 21993968 - 21994059
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
21993968 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
21994059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 21994179 - 21994270
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
21994179 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
21994270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 1007513 - 1007450
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1007513 |
aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
1007450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 17765150 - 17765245
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| ||||||| |||||| ||| |||||||| |
|
|
| T |
17765150 |
tattttgtaaggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatctgtcacgtgtacaaatcat |
17765245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 19320992 - 19320897
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
19320992 |
tattttgcagcgacctttttcaaaattaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
19320897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 389 - 467
Target Start/End: Complemental strand, 1007341 - 1007263
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgt |
467 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| ||||||||||| |
|
|
| T |
1007341 |
attttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcattcatcatgtgt |
1007263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 405 - 483
Target Start/End: Complemental strand, 12299026 - 12298948
Alignment:
| Q |
405 |
tttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
12299026 |
tttaagaatcaaaagattttggagggactatttttctaataaatgggttcaatcatcatgtgccacgtgtgcaaatcat |
12298948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 389 - 483
Target Start/End: Complemental strand, 25137217 - 25137123
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | ||||||||| ||| |||||||||||| |
|
|
| T |
25137217 |
attttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggtttagccatcatgtgccacgtgtgcaaatcat |
25137123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 3414385 - 3414446
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3414385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
3414446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 264 - 321
Target Start/End: Complemental strand, 12419942 - 12419885
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12419942 |
aataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccc |
12419885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 398 - 483
Target Start/End: Complemental strand, 24901453 - 24901368
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||| || ||||||||| |||| | |||||||||||| |||||||||||| |
|
|
| T |
24901453 |
ggacctttttcaaaatcgaaagattttgcagggactatttctctaataaatgggttcagttatcatgtgtcacgtgtgcaaatcat |
24901368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 265 - 326
Target Start/End: Complemental strand, 25137360 - 25137299
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25137360 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25137299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 3968869 - 3968778
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
3968869 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
3968778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 6412355 - 6412446
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
6412355 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
6412446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 263 - 327
Target Start/End: Complemental strand, 10910969 - 10910905
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
10910969 |
taataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
10910905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 20467575 - 20467484
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
20467575 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
20467484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 263 - 327
Target Start/End: Original strand, 21993782 - 21993846
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
21993782 |
taataggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaa |
21993846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 22543351 - 22543407
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22543351 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
22543407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 22543494 - 22543585
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
22543494 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
22543585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 32885670 - 32885726
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32885670 |
ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccc |
32885726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 10910739 - 10910834
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| |||| ||||||| |
|
|
| T |
10910739 |
tattttgcagggagctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggtttagtcatcatgtgccacgtgtgtaaatcat |
10910834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 265 - 320
Target Start/End: Original strand, 12419705 - 12419760
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12419705 |
ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 471
Target Start/End: Original strand, 19267705 - 19267788
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcaca |
471 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||| |||| | |||||||| |||| |
|
|
| T |
19267705 |
tattttgcagggacctttttaaaaatcaaaagattttgcaaggactatttttctaataaatgagttcagttatcatgtgccaca |
19267788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 21994405 - 21994350
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21994405 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
21994350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 264 - 318
Target Start/End: Complemental strand, 20467722 - 20467668
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20467722 |
aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
20467668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 21147401 - 21147463
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
21147401 |
ataggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgtaaa |
21147463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 1007122 - 1007183
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
1007122 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
1007183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 402 - 483
Target Start/End: Original strand, 3276143 - 3276224
Alignment:
| Q |
402 |
ctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||| || ||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
3276143 |
ctttttcaaaatcaaaagattttgcagagactatttctctaataaatgggttcagacatcatgtgtcacgtgtgcaaatcat |
3276224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 260 - 321
Target Start/End: Original strand, 8680767 - 8680828
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8680767 |
ttttaataggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccc |
8680828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 260 - 321
Target Start/End: Original strand, 21385243 - 21385304
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
21385243 |
ttttaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
21385304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 30479282 - 30479192
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||| | ||||||||||||||||||| ||||||||||||||||| |||| ||||||||| |||| |||||||||||||| || |||||| |
|
|
| T |
30479282 |
tattttgtagggacctttttaaaaatcaa--gattttgcagggactatatttctaataaatgggttcagtcatcatgtgtcacgtgcgcaaat |
30479192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 12299141 - 12299081
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
12299141 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
12299081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 266 - 318
Target Start/End: Complemental strand, 19321133 - 19321081
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19321133 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 22792900 - 22792840
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792900 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccccgtaaa |
22792840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 25136993 - 25137053
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25136993 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgtaaa |
25137053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 318101 - 318038
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
318101 |
aataggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgtaaa |
318038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 1214998 - 1214943
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
1214998 |
taggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccc |
1214943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 6412216 - 6412271
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
6412216 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
6412271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 7156162 - 7156107
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156162 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
7156107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 254 - 321
Target Start/End: Original strand, 14655365 - 14655432
Alignment:
| Q |
254 |
tatcagttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14655365 |
tatcatttttattaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
14655432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 15962389 - 15962330
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
15962330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 19690392 - 19690451
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
19690392 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19690451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 22543720 - 22543665
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
22543720 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
22543665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 262 - 321
Target Start/End: Original strand, 31198609 - 31198668
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
31198609 |
ttaatgggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccc |
31198668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 34582529 - 34582588
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
34582588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 3968644 - 3968698
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
3968644 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
3968698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 6412580 - 6412526
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
6412580 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccc |
6412526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 13268108 - 13268162
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
13268108 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccc |
13268162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 15076205 - 15076151
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15076205 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
15076151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 21385585 - 21385531
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
21385585 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccc |
21385531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 24274132 - 24274078
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24274132 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
24274078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 397 - 483
Target Start/End: Original strand, 27764958 - 27765044
Alignment:
| Q |
397 |
tggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||| |||||||| || | |||||||||||| |||||||||||| |
|
|
| T |
27764958 |
tggacctttttaaaaatcaaaagattttgcaaggattatttttctaataaatgagtttagccatcatgtgtcatgtgtgcaaatcat |
27765044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 33801744 - 33801690
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33801744 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
33801690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 3276355 - 3276302
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
3276355 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3276302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 8170153 - 8170100
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
8170153 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 13617531 - 13617588
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaa |
13617588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 18024377 - 18024316
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
18024377 |
taggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaa |
18024316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 25431856 - 25431795
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
25431856 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
25431795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 34582894 - 34582833
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
34582894 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgtaaa |
34582833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 494405 - 494457
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
494457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 318
Target Start/End: Complemental strand, 778044 - 777992
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
778044 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 415 - 483
Target Start/End: Complemental strand, 1214892 - 1214824
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| |||||| |||||||||||||| ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
1214892 |
aaaatattttgtagggactatttttctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
1214824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 263 - 327
Target Start/End: Complemental strand, 7324197 - 7324133
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
7324197 |
taataggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
7324133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 11448536 - 11448596
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11448536 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccccgtaaa |
11448596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 12757609 - 12757661
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
12757609 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12757661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 19129333 - 19129389
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19129333 |
ataggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccc |
19129389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 21995063 - 21995123
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
21995063 |
aggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgtaaa |
21995123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 315
Target Start/End: Original strand, 23502236 - 23502284
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23502236 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 26375692 - 26375752
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
26375692 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgtaaa |
26375752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 30928680 - 30928740
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
30928680 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
30928740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 269 - 321
Target Start/End: Original strand, 31166871 - 31166923
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
31166923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 1890454 - 1890399
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
1890454 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccc |
1890399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 2615870 - 2615925
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2615870 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccc |
2615925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 262 - 321
Target Start/End: Original strand, 7155791 - 7155850
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7155791 |
ttaaaaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
7155850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 388 - 455
Target Start/End: Complemental strand, 13268326 - 13268259
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattca |
455 |
Q |
| |
|
||||||||| |||||||||||||||| |||| ||||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
13268326 |
tattttgcagggacctttttaaaaattaaaaaattttgcagggactaattttctaataaatgggttca |
13268259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 14656261 - 14656202
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||||||||| |||| |
|
|
| T |
14656261 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
14656202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 15962025 - 15962080
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15962025 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
15962080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 318
Target Start/End: Original strand, 17765008 - 17765059
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
17765008 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 19296407 - 19296348
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaa |
19296348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 393 - 480
Target Start/End: Complemental strand, 21385470 - 21385384
Alignment:
| Q |
393 |
tgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| || ||||||||| |
|
|
| T |
21385470 |
tgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacatgtgtgcaaat |
21385384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 319
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 30929044 - 30928985
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
30928985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 3356495 - 3356445
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
3356445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 3414753 - 3414699
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
3414753 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccc |
3414699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 8681117 - 8681063
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8681117 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccc |
8681063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 14428651 - 14428709
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaa |
14428709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 20467354 - 20467404
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccc |
20467404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 22822652 - 22822598
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
22822652 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccc |
22822598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 23770162 - 23770220
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
23770220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 26376042 - 26375992
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
26375992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 388 - 450
Target Start/End: Complemental strand, 30037949 - 30037887
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatgg |
450 |
Q |
| |
|
||||||||| | |||| |||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30037949 |
tattttgcaggaacctctttaaaaatcgaaagattttgcagggactatttttctaataaatgg |
30037887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 269 - 327
Target Start/End: Complemental strand, 30479421 - 30479363
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| | | ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgtaaa |
30479363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 272 - 321
Target Start/End: Original strand, 543365 - 543414
Alignment:
| Q |
272 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
543414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 3356141 - 3356194
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
3356141 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3356194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 12176645 - 12176584
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
12176645 |
taggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
12176584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 12612361 - 12612300
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
12612361 |
taggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgtaaa |
12612300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 328
Target Start/End: Complemental strand, 13150751 - 13150690
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaac |
328 |
Q |
| |
|
||||||||||||||| || | ||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
13150751 |
aggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgtaaac |
13150690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 19267565 - 19267618
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccc |
19267618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 260 - 321
Target Start/End: Original strand, 33808612 - 33808673
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||| |||||||||||||||||| |||||| ||||||||||||||||| |||||||||| |
|
|
| T |
33808612 |
ttttaagaggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccc |
33808673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 11449170 - 11449110
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
11449170 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgtaaa |
11449110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 17771911 - 17771963
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
17771963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 18024014 - 18024070
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgtaaa |
18024070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 19129522 - 19129462
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
19129522 |
taggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgtaa |
19129462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 25121498 - 25121438
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
25121498 |
taggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgtaa |
25121438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 390 - 466
Target Start/End: Complemental strand, 31276277 - 31276201
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtg |
466 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| |||||||||| ||||||||| |||| |||||||||| |
|
|
| T |
31276277 |
ttttgcagtgaccattttaaaaatcaaaagattttgcaatgactatttttttaataaatgggttcagtcatcatgtg |
31276201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 33131851 - 33131791
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33131851 |
aggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgtaaa |
33131791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 34990312 - 34990256
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
34990256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 270 - 321
Target Start/End: Complemental strand, 5286949 - 5286898
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
5286898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 10910629 - 10910688
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| || || |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgtaaa |
10910688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 327
Target Start/End: Complemental strand, 13617804 - 13617757
Alignment:
| Q |
280 |
gttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
13617757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 421 - 480
Target Start/End: Complemental strand, 15722802 - 15722743
Alignment:
| Q |
421 |
ttttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| | |||||||||||| ||||||||| |
|
|
| T |
15722802 |
ttttgcagggactatttttctaataaatgggttcagttatcatgtgtcacgtgtgcaaat |
15722743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 21995425 - 21995366
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgtaaa |
21995366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 23502541 - 23502482
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |||| |||| |
|
|
| T |
23502541 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgtaa |
23502482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 318
Target Start/End: Original strand, 24273827 - 24273878
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
24273827 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
24273878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 24692981 - 24692926
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
24692981 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccc |
24692926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 31186591 - 31186532
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgtaaa |
31186532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 2373178 - 2373232
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
2373178 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccc |
2373232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 6468309 - 6468363
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
6468309 |
aggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccc |
6468363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 12298825 - 12298875
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccc |
12298875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 268 - 318
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||| ||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 265 - 319
Target Start/End: Original strand, 25121181 - 25121234
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
25121181 |
ataggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtc |
25121234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 317810 - 317871
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
317810 |
taggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgtaaa |
317871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 6564578 - 6564635
Alignment:
| Q |
265 |
ataggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||| |
|
|
| T |
6564578 |
ataggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagtccc |
6564635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 6564945 - 6564893
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
6564945 |
taggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtc |
6564893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 9896280 - 9896337
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| ||||||||||| ||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgtaaa |
9896337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 9896638 - 9896585
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
9896638 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 15722902 - 15722849
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
15722902 |
taggctaaaatatagttttgattcctgcaaatatgccttgtgttggttttagtc |
15722849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 31167200 - 31167147
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccc |
31167147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 326
Target Start/End: Original strand, 1875500 - 1875560
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||| | ||| |||||||||||||||||||||||||| ||| ||||| |||| |
|
|
| T |
1875500 |
taggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctgtaa |
1875560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 315
Target Start/End: Complemental strand, 2616241 - 2616193
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
2616241 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 315
Target Start/End: Original strand, 6591114 - 6591162
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
6591114 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 10091039 - 10091095
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaa |
10091095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 326
Target Start/End: Original strand, 15722608 - 15722668
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||||| |||||||||| |||| |
|
|
| T |
15722608 |
taggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgtaa |
15722668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 17765376 - 17765316
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
17765376 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgtaaa |
17765316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 19296107 - 19296167
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
19296107 |
aggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgtaaa |
19296167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 19320769 - 19320825
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||||||||||| |||| |||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgtaa |
19320825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 415 - 483
Target Start/End: Complemental strand, 31185832 - 31185764
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
31185832 |
aaaatattttgcagggactatttctctaataaatgagttcagtcatcatgtgccacgtgtgcaaatcat |
31185764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 11129543 - 11129496
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
11129543 |
ggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 14655903 - 14655962
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgtaaa |
14655962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 267 - 318
Target Start/End: Original strand, 22822306 - 22822357
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
22822306 |
aggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 266 - 309
Target Start/End: Complemental strand, 23770441 - 23770398
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgtttt |
309 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23770441 |
taggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 269 - 320
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 777676 - 777730
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| |||| | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
777676 |
aggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccc |
777730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 1214695 - 1214749
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| | | |||||||||||||||| |
|
|
| T |
1214695 |
aggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccc |
1214749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 1890062 - 1890112
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| |||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccc |
1890112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 264 - 318
Target Start/End: Complemental strand, 11926037 - 11925983
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||| || ||| ||||||| | ||||||||||||||| |
|
|
| T |
11926037 |
aataggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt |
11925983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 320
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc |
14428898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 319
Target Start/End: Original strand, 23628799 - 23628849
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc |
23628849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 24901556 - 24901495
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||| || |||||||||||||||| ||||| |
|
|
| T |
24901556 |
taggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgtaaa |
24901495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 30239293 - 30239346
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| |||| | |||||||||||| |||||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccc |
30239346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #166
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 260 - 313
Target Start/End: Original strand, 30479055 - 30479108
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt |
313 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||| ||||||| | |||||||||| |
|
|
| T |
30479055 |
tttttataggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #167
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 31276339 - 31276282
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||| |||||||||| |||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgtaa |
31276282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #168
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 31398542 - 31398489
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
31398542 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc |
31398489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #169
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 388 - 432
Target Start/End: Original strand, 6468449 - 6468493
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
6468449 |
tattttgcagggacctttttaaaaaacaaaatattttgcagggac |
6468493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #170
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 270 - 318
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #171
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 388 - 481
Target Start/End: Complemental strand, 14656120 - 14656035
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatc |
481 |
Q |
| |
|
||||||| | ||||||||||||||||||||| | |||||||||||| |||| |||| |||| | ||||||||||||||||||||||| |
|
|
| T |
14656120 |
tattttgtagggacctttttaaaaatcaaaaaaatttgcagggact--------aatagatgggttcagtgatcatgtgtcacatgtgcaaatc |
14656035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #172
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 272 - 320
Target Start/End: Complemental strand, 19690755 - 19690708
Alignment:
| Q |
272 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtcc |
19690708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #173
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 543726 - 543671
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| | |||||||||||| |||| |
|
|
| T |
543726 |
taggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccc |
543671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #174
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 7323863 - 7323927
Alignment:
| Q |
267 |
aggctaaaatatggttttgat----ccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| || || |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
7323863 |
aggctaaaatatggttttaattagcccttgcaaatatgtctcgttttggttttagtccctgtaaa |
7323927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #175
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 319
Target Start/End: Original strand, 11925739 - 11925790
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||| ||||| ||||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtc |
11925790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #176
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 12176522 - 12176565
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
12176522 |
attttgcagggacctttttaaaaaacaaaaaattttgcagggac |
12176565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #177
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 12611995 - 12612054
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| ||||| |||||||| |||||||| |
|
|
| T |
12611995 |
ggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagttcccgtaaa |
12612054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #178
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 19267913 - 19267854
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| | |||| ||||||| | | |||||||||||||||| |||| |
|
|
| T |
19267913 |
aggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgtaa |
19267854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #179
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 20582749 - 20582792
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
20582749 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
20582792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #180
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 23770300 - 23770343
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
23770300 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
23770343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #181
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 34990093 - 34990136
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
34990093 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
34990136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #182
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 432
Target Start/End: Complemental strand, 14428861 - 14428819
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
14428861 |
ttttgcagggacctttttaaaaaacaaaatattttgcagggac |
14428819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #183
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 15116671 - 15116730
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
15116671 |
taggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagttccggtaaa |
15116730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #184
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 281 - 319
Target Start/End: Complemental strand, 19275223 - 19275185
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
19275185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #185
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 432
Target Start/End: Complemental strand, 21995286 - 21995244
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
21995286 |
ttttgcagggacctttttaaaaaacaaaatattttgcagggac |
21995244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #186
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 31276105 - 31276155
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| |||||||||| ||||| |||||||||||| |||||||||| ||||| |
|
|
| T |
31276105 |
taaactatggttttggtccctacaaatatgcctcattttggttttggtccc |
31276155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #187
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 265 - 299
Target Start/End: Original strand, 34995111 - 34995145
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34995111 |
ataggctaaaatatgcttttgatccctgcaaatat |
34995145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #188
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 267 - 304
Target Start/End: Complemental strand, 15117041 - 15117004
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctc |
304 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15117041 |
aggctaaaatatggttttagtccctgcaaatatgcctc |
15117004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #189
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 19276041 - 19275980
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| |||||||| ||||| ||||| ||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
19276041 |
taggttaaaatatagttttagtccctacaaatatacctcattttggttttagtccctgtaaa |
19275980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #190
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 299
Target Start/End: Complemental strand, 34998202 - 34998169
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
34998202 |
taggctaaaatatgcttttgatccctgcaaatat |
34998169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #191
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 1007197 - 1007237
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
1007197 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
1007237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #192
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 1214767 - 1214807
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
1214767 |
ttttggtccctgcaaatatgtcttgttttggttttagtccc |
1214807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #193
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 288 - 320
Target Start/End: Original strand, 5286606 - 5286638
Alignment:
| Q |
288 |
ccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
5286606 |
ccctgcaaatatgcctcgttttgattttagtcc |
5286638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #194
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 13268182 - 13268222
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
13268182 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
13268222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #195
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 17765302 - 17765262
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
17765302 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
17765262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #196
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 19129447 - 19129407
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
19129407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #197
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 263 - 299
Target Start/End: Complemental strand, 20897561 - 20897525
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
20897561 |
taattggctaaaatatggttttggtccctgcaaatat |
20897525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #198
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 24901311 - 24901351
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
24901311 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
24901351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #199
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 25137066 - 25137106
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
25137066 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
25137106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #200
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 25431575 - 25431635
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| |||||||| ||||||| || ||||| |
|
|
| T |
25431575 |
aggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgtaaa |
25431635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #201
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 31198688 - 31198728
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
31198688 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
31198728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 76; Significance: 6e-35; HSPs: 215)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 28213598 - 28213503
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
28213598 |
tattttgcatggacctttttaaaaatcaaaagattttgcagagactatttttctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
28213503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 20661173 - 20661078
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
20661173 |
tattttgcagggacctttttaaaaatcaaaagattttacagggactatttttctaataaatgagttcaatcatcatgtgtcacgtgtgcaaatcat |
20661078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 5103786 - 5103880
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||| |||| ||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
5103786 |
tattttgcagggacctttttaaaaatcaaaagattttgcagg-actatatttctaataaatgggttcagtcatcatgtgtcacatgtgcaaatcat |
5103880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 26071515 - 26071420
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| || |||||||||||| |
|
|
| T |
26071515 |
tattttgcaaggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgctacgtgtgcaaatcat |
26071420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 36973578 - 36973483
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
36973578 |
tattttgcagtgacctttttcaaaatcaaaagattttgcagggactatttctctaataaatggattcagtcatcatgtgtcacgtgtgcaaatcat |
36973483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 1286822 - 1286917
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||| ||||||||| |||||||||| |
|
|
| T |
1286822 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttccaataaatgggttcagtcattatgtgtcacgcttgcaaatcat |
1286917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 12145018 - 12145113
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||| ||||||||||| | ||||||||||||| |
|
|
| T |
12145018 |
tattttgcagagacctttttaaaaatcaaaagattttgcatggactatttttctaataaatgggttcactcatcatgtgttatatgtgcaaatcat |
12145113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 398 - 483
Target Start/End: Complemental strand, 10830744 - 10830659
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||| ||||| |||||||| |||||||||||| |
|
|
| T |
10830744 |
ggacctttttaaaaatcaaaagattttgcagggattatttttctaataaatgggttcagtcatcttgtgtcacgtgtgcaaatcat |
10830659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 32888905 - 32888810
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| ||| |||| ||||||| |
|
|
| T |
32888905 |
tattttgcagagaccttttcaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacgtgtgtaaatcat |
32888810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 35609497 - 35609403
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||| |||| ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
35609497 |
tattttgcagggacctttttaaaaattaaaagattttgcagggacta-ttttataataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
35609403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 388 - 494
Target Start/End: Original strand, 45278 - 45384
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataacc |
487 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||| || | ||||||||| ||| |||||||||||| || |
|
|
| T |
45278 |
tattttgcatggacctttttcaaaatcaaaagattttgcagggactatttctttaataaatgggtttagtcatcatgtaccacgtgtgcaaatcatcaca |
45377 |
T |
|
| Q |
488 |
aaaatga |
494 |
Q |
| |
|
||||||| |
|
|
| T |
45378 |
aaaatga |
45384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 390 - 483
Target Start/End: Original strand, 38554864 - 38554956
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
38554864 |
ttttgcagggaccattttaaaaatcaaaagattttacagggactatttttctcataaatggattcagtcatcatgtgtca-gtgtgcaaatcat |
38554956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 1381387 - 1381478
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
1381387 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
1381478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 18258387 - 18258296
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
18258387 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
18258296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 5904148 - 5904243
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||| | ||||| |||||| | |||||||||| |
|
|
| T |
5904148 |
tattttgtagggacctttttaaaaatcaaaagattttgcatggactatttttctaataaatgggttcagttatcatatgtcacgtatgcaaatcat |
5904243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 17070760 - 17070665
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||| |||||||||||| | ||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
17070760 |
tattttgcagagacctttttaaaaatcaaaatattttgcaaggactatttttctacaaaatggattcattcatcatgtgccacgtgtgcaaatcat |
17070665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 28108024 - 28107929
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||| ||||||||||||||||||||||||||||| || |||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
28108024 |
tattttgcaaggagctttttcaaaatcaaaagattttgcagggactatttctctaataaatgagttcagtcatcatgtgccacgtgtgcaaatcat |
28107929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 31602372 - 31602277
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||| || ||||||||||||||||||||| | |||||| |||||| |||||||| ||| |||||||||||| |
|
|
| T |
31602372 |
tattttgcagggacctttttaaaaatcataatattttgcagggactatttttctacaaaatgggttcaattatcatgtgccacgtgtgcaaatcat |
31602277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 42596678 - 42596583
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |||||||||||||| ||||||||| |||| | ||||||||||| ||| |||||||| |
|
|
| T |
42596678 |
tattttgcatagacctttttaaaaatcaaacgattttgtagggactatttttctaataaatgggttcagttatcatgtgtcatgtgtccaaatcat |
42596583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 409 - 483
Target Start/End: Original strand, 1104944 - 1105018
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
1104944 |
aaaatcaaaagattttgcagggactatttctctaataaatgggttcaatcatcatgtgccacgtgtgcaaatcat |
1105018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 265 - 327
Target Start/End: Complemental strand, 24443747 - 24443685
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24443747 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
24443685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 398 - 483
Target Start/End: Complemental strand, 42553859 - 42553774
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||| |||||||| |||| | |||||||||||| |||||||||||| |
|
|
| T |
42553859 |
ggacctttttaaaaatcaaaagattttggagggactacttttctaataaatgagttcagttatcatgtgtcacgtgtgcaaatcat |
42553774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 6912722 - 6912631
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||| | || | |||||||||| ||||||||||||| |
|
|
| T |
6912722 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaat-gtttaagtcatcatgtgacacatgtgcaaat |
6912631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 19565607 - 19565698
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
19565607 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
19565698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 19685240 - 19685149
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
19685240 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
19685149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 19685381 - 19685321
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19685381 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
19685321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 20985949 - 20985858
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
20985949 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
20985858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 24443604 - 24443513
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
24443604 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
24443513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 35928288 - 35928197
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
35928288 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
35928197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 38170513 - 38170573
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38170513 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
38170573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 40764639 - 40764548
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||| | || | |||||||||| ||||||||||||| |
|
|
| T |
40764639 |
tattttgcaaggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatag-ttaagtcatcatgtgacacatgtgcaaat |
40764548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 1105150 - 1105095
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1105150 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
1105095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 19565833 - 19565778
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19565833 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
19565778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 1381612 - 1381558
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1381612 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
1381558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 5917461 - 5917407
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5917461 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
5917407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 388 - 466
Target Start/End: Original strand, 9588387 - 9588465
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtg |
466 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| ||||||||| || ||||||||| |||| |||||||||| |
|
|
| T |
9588387 |
tattttgcacggacctttttcaaaatcaaaagattttgcatggactatttctctaataaatgggttcagtcatcatgtg |
9588465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 388 - 466
Target Start/End: Complemental strand, 28871861 - 28871783
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtg |
466 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||| ||||| || ||||||||| |||| |||||||||| |
|
|
| T |
28871861 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggattatttctctaataaatgggttcagtcatcatgtg |
28871783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 30800491 - 30800553
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30800491 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
30800553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 35928063 - 35928117
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35928063 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
35928117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 40764414 - 40764468
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40764414 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40764468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 40764781 - 40764727
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40764781 |
aggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccc |
40764727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 1104856 - 1104917
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
1104856 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaa |
1104917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 5950174 - 5950235
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5950174 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
5950235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 6912497 - 6912550
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
6912550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 20660947 - 20661000
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20660947 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20661000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 29692742 - 29692803
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29692742 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
29692803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 37271357 - 37271418
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37271357 |
taggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaa |
37271418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 1381246 - 1381306
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
1381246 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
1381306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 2217493 - 2217553
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2217493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
2217553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 403 - 483
Target Start/End: Complemental strand, 2636879 - 2636799
Alignment:
| Q |
403 |
tttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| |||||||||||| |
|
|
| T |
2636879 |
tttttcaaaatcaaaagattttgcagggactatttctctaataaatgggtttagtcatcatgtgccacgtgtgcaaatcat |
2636799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 5917123 - 5917179
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
5917123 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
5917179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 7075571 - 7075631
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7075571 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
7075631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 19685014 - 19685070
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
19685014 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
19685070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 21124912 - 21124972
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
21124912 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaa |
21124972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 28863509 - 28863569
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28863509 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
28863569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 30800852 - 30800792
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30800852 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30800792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 35876912 - 35876821
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||| ||| || ||||||||| |||| |||||||||| ||| ||| ||||| |
|
|
| T |
35876912 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactgtttctctaataaatgg-ttcagtcatcatgtgacacgtgtacaaat |
35876821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 36578084 - 36578024
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36578084 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
36578024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 37271482 - 37271573
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
37271482 |
tattttgcagggaccttttacaaaataaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
37271573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 264 - 316
Target Start/End: Original strand, 40038490 - 40038542
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40038490 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 45138 - 45197
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
45197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 269 - 320
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 393 - 480
Target Start/End: Original strand, 5917240 - 5917326
Alignment:
| Q |
393 |
tgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
5917240 |
tgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
5917326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 319
Target Start/End: Original strand, 20690729 - 20690784
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
20690729 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20690784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 28863838 - 28863779
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
28863779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 29855832 - 29855737
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| |||||||||||||| |||||||| |||| || ||||||| | | |||||||||||| |
|
|
| T |
29855832 |
tattttgcagggatctttttaaaaatcaaaagattttttagggactatttttctcataaatgggttcagtcgtcatgtgccgcgtgtgcaaatcat |
29855737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 29875727 - 29875672
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29875727 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
29875672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 35928458 - 35928399
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
35928399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 40029497 - 40029438
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
40029438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 40038719 - 40038625
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||| |||| ||||||||||||||| ||||||||| || ||||||| | |||| |||||||||| ||| |||||||||||| |
|
|
| T |
40038719 |
tattttgcagggaccttttcaaaa-tcaaaagattttgcatggactatttctctaataaataggttcagtcatcatgtgccacgtgtgcaaatcat |
40038625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 2217855 - 2217801
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
2217801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 18046350 - 18046296
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18046350 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18046296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 18633598 - 18633652
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18633598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
18633652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 19565466 - 19565520
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
19565466 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
19565520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 20985728 - 20985778
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
20985778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 20986090 - 20986036
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
20986090 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccc |
20986036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 24443379 - 24443433
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
24443379 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccc |
24443433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 29172887 - 29172833
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29172887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
29172833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 29875399 - 29875453
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29875399 |
aggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccc |
29875453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 32109011 - 32108937
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||| ||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
32109011 |
aaaatcaaaagattttgcaaggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
32108937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 35167166 - 35167112
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35167166 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
35167112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 35876687 - 35876741
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35876687 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
35876741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 36577719 - 36577781
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
36577719 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
36577781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 5614532 - 5614471
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
5614532 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
5614471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 5904006 - 5904067
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
5904006 |
taggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgtaaa |
5904067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 270 - 327
Target Start/End: Complemental strand, 6912855 - 6912798
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
6912798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 10743723 - 10743776
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10743723 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
10743776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 16038376 - 16038429
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16038376 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16038429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 18258528 - 18258475
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
18258528 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
18258475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 28213372 - 28213425
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
28213372 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 28550827 - 28550880
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
28550880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 30888160 - 30888213
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
30888213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 262 - 327
Target Start/End: Complemental strand, 33336032 - 33335967
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
33336032 |
ttaattggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaaa |
33335967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 35877054 - 35876993
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
35877054 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaaa |
35876993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 4736543 - 4736483
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
4736543 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaa |
4736483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 11799459 - 11799399
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgtaaa |
11799399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 26133414 - 26133354
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
26133414 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
26133354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 28871995 - 28871935
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
28871995 |
aggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
28871935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 269 - 321
Target Start/End: Original strand, 29172524 - 29172576
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
29172576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 38786158 - 38786218
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
38786158 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
38786218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 40167785 - 40167845
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40167785 |
aggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
40167845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 261 - 320
Target Start/End: Original strand, 293821 - 293880
Alignment:
| Q |
261 |
tttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
293821 |
tttaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 1286682 - 1286741
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| ||| ||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgtaaa |
1286741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 318
Target Start/End: Original strand, 4203455 - 4203506
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4203455 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 20661311 - 20661252
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaaa |
20661252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 271 - 326
Target Start/End: Complemental strand, 26071613 - 26071558
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgtaa |
26071558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 26133183 - 26133242
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaa |
26133242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 271 - 326
Target Start/End: Complemental strand, 28108159 - 28108104
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
28108104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 260 - 327
Target Start/End: Complemental strand, 40168016 - 40167949
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||| ||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
40168016 |
ttttaataggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgtaaa |
40167949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 409 - 483
Target Start/End: Original strand, 4736338 - 4736412
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||| |||||||||| || ||||||||| |||| |||||||||| ||| |||||| ||||| |
|
|
| T |
4736338 |
aaaatcaaaagattttgccgggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcagatcat |
4736412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 10408927 - 10408981
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
10408927 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccc |
10408981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 15635708 - 15635654
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
15635708 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccc |
15635654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 18258161 - 18258215
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||||| |
|
|
| T |
18258161 |
aggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccc |
18258215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 316
Target Start/End: Complemental strand, 25562001 - 25561951
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25562001 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 34125305 - 34125359
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34125305 |
taggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
34125359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 35609303 - 35609361
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgtaa |
35609361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 37271707 - 37271653
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
37271707 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccc |
37271653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 38554749 - 38554800
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38554749 |
taggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagtc |
38554800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 263 - 321
Target Start/End: Original strand, 39379234 - 39379292
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39379234 |
taataggttaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccc |
39379292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 39379612 - 39379558
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
39379612 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 4203772 - 4203711
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
4203772 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaa |
4203711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 6118499 - 6118446
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccc |
6118446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 10409328 - 10409275
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
10409328 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 10744056 - 10743995
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
10744056 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaaa |
10743995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 12144903 - 12144960
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||| |||||||||||||||| |
|
|
| T |
12144903 |
aataggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccc |
12144960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 13990896 - 13990843
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13990896 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13990843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 262 - 327
Target Start/End: Original strand, 18046032 - 18046097
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
18046032 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaa |
18046097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 18633961 - 18633908
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccc |
18633908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 24781985 - 24782042
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| |||||||||||||||||||| |
|
|
| T |
24781985 |
aataggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccc |
24782042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 25561705 - 25561758
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccc |
25561758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 9179921 - 9179861
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
9179921 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgtaaa |
9179861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 23382297 - 23382245
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc |
27916713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 265 - 313
Target Start/End: Original strand, 31602140 - 31602188
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt |
313 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
31602140 |
ataggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt |
31602188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 34125633 - 34125573
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
34125633 |
aggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaaa |
34125573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 270 - 318
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 42596814 - 42596758
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaaa |
42596758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 319
Target Start/End: Original strand, 2636669 - 2636720
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 3850601 - 3850546
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
3850601 |
taggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
3850546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 21050913 - 21050854
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgtaaa |
21050854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 318
Target Start/End: Complemental strand, 29151852 - 29151801
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
29151852 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
29151801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 36973710 - 36973651
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaaa |
36973651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 38555085 - 38555031
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||| |||||||||||||||| |
|
|
| T |
38555085 |
taggctaaaatatggtttgg-tccctgcaaatatgcctcattttggttttagtccc |
38555031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 40038858 - 40038799
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| |||||||||||| |||| ||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaaa |
40038799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 319
Target Start/End: Original strand, 42553642 - 42553693
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
42553693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 11799128 - 11799182
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
11799128 |
aggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccc |
11799182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 14318043 - 14318097
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
14318043 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
14318097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 23381947 - 23382009
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || |||||||||||||| || ||||| |
|
|
| T |
23381947 |
ataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgtaaa |
23382009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 268 - 318
Target Start/End: Complemental strand, 29366949 - 29366899
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
29366899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 266 - 316
Target Start/End: Complemental strand, 31037743 - 31037693
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31037743 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 272 - 326
Target Start/End: Original strand, 32888691 - 32888745
Alignment:
| Q |
272 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| ||||||||||| |||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgtaa |
32888745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 317
Target Start/End: Original strand, 35166910 - 35166960
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
317 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
35166910 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 36278079 - 36278133
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||| |||||||||| |
|
|
| T |
36278079 |
taggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtcc |
36278133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 38496783 - 38496729
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
38496783 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccc |
38496729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 5614165 - 5614218
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
5614165 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
5614218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 271 - 320
Target Start/End: Complemental strand, 9532532 - 9532483
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
9532483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 15916286 - 15916339
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| ||| |||||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccc |
15916339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 270 - 319
Target Start/End: Complemental strand, 16038738 - 16038689
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
16038689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 25779164 - 25779103
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||||| || ||||| |
|
|
| T |
25779164 |
taggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgtaaa |
25779103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 28871635 - 28871696
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
28871635 |
taggttaaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgtaaa |
28871696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 29151516 - 29151569
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccc |
29151569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 29693091 - 29693038
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
29693091 |
aggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtcc |
29693038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 32108806 - 32108867
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |||||| |||| ||||| |
|
|
| T |
32108806 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgtaaa |
32108867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 42207240 - 42207301
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
42207240 |
taggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaaa |
42207301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 2032940 - 2032888
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||| ||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 3850299 - 3850359
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttgg-ttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctgtaaa |
3850359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 9179592 - 9179652
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgtaaa |
9179652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 318
Target Start/End: Original strand, 10830527 - 10830579
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||| || || ||||||||||| |||||||||||||| |
|
|
| T |
10830527 |
taggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagt |
10830579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 17070534 - 17070593
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||| |||| |||||||||| ||||| |
|
|
| T |
17070534 |
aggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctgtaaa |
17070593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 20416359 - 20416419
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||| |||||||| |||||| ||||| |
|
|
| T |
20416359 |
aggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtcccggtaaa |
20416419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 20683746 - 20683806
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
20683746 |
aggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgtaaa |
20683806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 20690957 - 20690861
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaaga-ttttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||| |||| || ||||||| |||| |||||||| |||| |||||||||| || | |||||||||| |
|
|
| T |
20690957 |
tattttgcagggatctttttaaaaatcaaaagattttttcatggactatatttctaataaatgagttcattcatcatgtgccatgtatgcaaatcat |
20690861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 40029140 - 40029200
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
40029140 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgtaaa |
40029200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 260 - 327
Target Start/End: Complemental strand, 17070871 - 17070804
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| |||||||| |||||||| ||||||| ||| ||||| |
|
|
| T |
17070871 |
tttttataggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctgtaaa |
17070804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 267 - 318
Target Start/End: Complemental strand, 18286742 - 18286691
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
18286742 |
aggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 31156127 - 31156084
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
31156127 |
attttgcatggacctttttaaaaaacaaaatattttgcagggac |
31156084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 35166160 - 35166105
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||| ||||||||||| |||||||||| ||| |||||||||||||||||||| |
|
|
| T |
35166160 |
taggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccc |
35166105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 267 - 318
Target Start/End: Original strand, 42596452 - 42596503
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || |||||||||||||| |
|
|
| T |
42596452 |
aggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagt |
42596503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 318
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||| ||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 26071290 - 26071344
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||| ||| |||||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccc |
26071344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 318
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 316
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 318
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 271 - 316
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 3851331 - 3851270
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
3851331 |
taggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgtaaa |
3851270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 270 - 315
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 270 - 319
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 270 - 319
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||| ||||| | |||||||||||| |||||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 29855614 - 29855671
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||| ||||| ||| || ||||||||||| |||||||||||||||| |||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgtaa |
29855671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 269 - 320
Target Start/End: Complemental strand, 9588611 - 9588559
Alignment:
| Q |
269 |
gctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||| |||| | |||||||||||||| ||||||||||||||||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtcc |
9588559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 20418013 - 20417957
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| || ||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccccgtaaa |
20417957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 268 - 316
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 271 - 318
Target Start/End: Complemental strand, 1287042 - 1286995
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||| ||||||||||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagt |
1286995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 10830899 - 10830844
Alignment:
| Q |
266 |
taggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||| |||| | ||||||||||||||||| ||||||||||||||| |
|
|
| T |
10830899 |
taggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagtcc |
10830844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 21050575 - 21050634
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgtaaa |
21050634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 270 - 321
Target Start/End: Complemental strand, 27850372 - 27850321
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||| |||| || ||||||||||| |||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccc |
27850321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 31155483 - 31155526
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
31155483 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
31155526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 267 - 314
Target Start/End: Complemental strand, 38182088 - 38182041
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
314 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38182088 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 267 - 314
Target Start/End: Original strand, 38189043 - 38189090
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
314 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38189043 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 267 - 314
Target Start/End: Complemental strand, 38209314 - 38209267
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
314 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38209314 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 267 - 314
Target Start/End: Original strand, 38216268 - 38216315
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
314 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38216268 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 270 - 321
Target Start/End: Complemental strand, 42207570 - 42207520
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||| | ||||||||||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccc |
42207520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 266 - 312
Target Start/End: Original strand, 4736203 - 4736249
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
312 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
4736203 |
taggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 389 - 431
Target Start/End: Original strand, 14318179 - 14318221
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcaggga |
431 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
14318179 |
attttgcaaggacctttttaaaaaacaaaatattttgcaggga |
14318221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #205
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 15635379 - 15635429
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||| |||||||||| || ||||||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccc |
15635429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #206
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 281 - 315
Target Start/End: Original strand, 28213446 - 28213480
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28213446 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28213480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #207
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 281 - 319
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #208
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 389 - 431
Target Start/End: Complemental strand, 42207463 - 42207421
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcaggga |
431 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
42207463 |
attttgcatggaccttttttaaaaacaaaatattttgcaggga |
42207421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #209
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 391 - 432
Target Start/End: Original strand, 3850604 - 3850645
Alignment:
| Q |
391 |
tttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
3850604 |
tttgcagggacctttttaaaaaacaaaatattttgcagggac |
3850645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #210
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 311
Target Start/End: Original strand, 7085476 - 7085520
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttgg |
311 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||| ||||||| |
|
|
| T |
7085476 |
taggctaaaatatggttttg-tccctgtaaatatgccttgttttgg |
7085520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #211
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 270 - 319
Target Start/End: Original strand, 31037397 - 31037446
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||| |||||| |||||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtc |
31037446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #212
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 1105075 - 1105035
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
1105075 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
1105035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #213
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 1286974 - 1286934
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
1286974 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
1286934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #214
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 28871711 - 28871751
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||||| |
|
|
| T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
28871751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #215
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 32888760 - 32888800
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32888760 |
ttttggtccctgcaaatatgccttgttttggttttggtccc |
32888800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 6e-35; HSPs: 290)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 52543504 - 52543599
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
52543504 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatggattcagtcatcatgtgacacgtgtgcaaatcat |
52543599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 388 - 493
Target Start/End: Original strand, 42823866 - 42823971
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataacc |
487 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||| || |
|
|
| T |
42823866 |
tattttgcagggacctttttaaaaattaaaagattttgcagggactatttttctaataaatgagttcagtcatcatgtgtcacatgtgcaaatcatcaca |
42823965 |
T |
|
| Q |
488 |
aaaatg |
493 |
Q |
| |
|
|||||| |
|
|
| T |
42823966 |
aaaatg |
42823971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 4211726 - 4211631
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
4211726 |
tattttgcagggacatttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcaatcatcatgtgccacgtgtgcaaatcat |
4211631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 5203068 - 5203163
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||| || |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
5203068 |
tattttacagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgtcacatgtgcaaatcat |
5203163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 14791641 - 14791736
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||| |||||| |||||||||||| |
|
|
| T |
14791641 |
tattttgcaaggacctttttaaaaatcaaaagattttacagggactatttttctaataaatgggttcaatcatcaagtgtcaagtgtgcaaatcat |
14791736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 35119488 - 35119393
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||| ||| |||||||||||| |
|
|
| T |
35119488 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtaccacgtgtgcaaatcat |
35119393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 12791749 - 12791844
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||||| ||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
12791749 |
tattttgcagggacctttttaaaaatcaaaatattttgcagggactattttactaataattgggttcagtcatcatgtgtcacgtgtgcaaatcat |
12791844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 13073985 - 13073890
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||| ||| |||||||||||| |
|
|
| T |
13073985 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcggtcatcatgtaccacgtgtgcaaatcat |
13073890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 24774202 - 24774297
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
24774202 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
24774297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 25424087 - 25424182
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
25424087 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
25424182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 31182349 - 31182255
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| ||||||||||||||| ||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
31182349 |
tattttgcagggacctttttcaaaatcaaaagattttacagggactatttttctaataaatag-ttcaatcatcatgtgtcacgtgtgcaaatcat |
31182255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 2034630 - 2034724
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| || ||||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
2034630 |
tattttgcaggggcctttttcaaaatcaaaagattttgcagggacta-ttttctaataaatggattcagtcatcatgtgccacgtgtgcaaatcat |
2034724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 5827879 - 5827785
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||| |||||||||| ||||| |||||||||| |
|
|
| T |
5827879 |
tattttgca-ggacctttttacaaatcaaaagattttgcagggactatttttctaataaatgagttcactcatcatgtgccacatatgcaaatcat |
5827785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 14487962 - 14488057
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || |||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
14487962 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgagttcagtcatcatgtgccacgtgtgcaaatcat |
14488057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 19903486 - 19903391
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||| || |||||||||||||||||||||||||||||| ||||||| | |||| |||||||||| |||||||||||||||| |
|
|
| T |
19903486 |
tattttgcagggacctttatacaaatcaaaagattttgcagggactatttttttaataaattggttcactcatcatgtgccacatgtgcaaatcat |
19903391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 46115554 - 46115649
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| |||||||||||| |
|
|
| T |
46115554 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggtttagtcatcatgtgccacgtgtgcaaatcat |
46115649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 46128688 - 46128783
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| |||||||||||| |
|
|
| T |
46128688 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggtttagtcatcatgtgccacgtgtgcaaatcat |
46128783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 54903251 - 54903346
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| | || ||||||||| |||||||||| |
|
|
| T |
54903251 |
tattttgcagggacctttttaaaaatcaaaagattttgcaggaactatttttctaataaatggattcagttattatgtgtcacgcttgcaaatcat |
54903346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 389 - 483
Target Start/End: Original strand, 5797596 - 5797690
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
5797596 |
attttgcagtgacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
5797690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 398 - 483
Target Start/End: Original strand, 2322217 - 2322302
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||| || ||||||||||| |||||||||||| |
|
|
| T |
2322217 |
ggacctttttaaaaatcaaaagattttacaggaactatttttctaataaatggattcggtcgtcatgtgtcacgtgtgcaaatcat |
2322302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 388 - 493
Target Start/End: Original strand, 8905010 - 8905115
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataacc |
487 |
Q |
| |
|
||||||| | |||| |||||||||||||||| |||||||||||| |||||||| ||||||||||||| |||| ||||||||| |||||||||||| || |
|
|
| T |
8905010 |
tattttgtagggacttttttaaaaatcaaaatattttgcagggattatttttctaataaatggattcggtcattatgtgtcacgtgtgcaaatcatcaca |
8905109 |
T |
|
| Q |
488 |
aaaatg |
493 |
Q |
| |
|
|||||| |
|
|
| T |
8905110 |
aaaatg |
8905115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 398 - 483
Target Start/End: Original strand, 20292103 - 20292188
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| || |||||||| || |||||||||||||||| |||||||||||| |
|
|
| T |
20292103 |
ggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgagtttaatcatcatgtgtcacgtgtgcaaatcat |
20292188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 389 - 493
Target Start/End: Original strand, 30564974 - 30565078
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataacca |
488 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||| ||||||| | |||| ||||| | |||| | |||||||||||| || | |
|
|
| T |
30564974 |
attttgcagggacctttttcaaaatcaaaagattttgcagggactatttttctaataaataggttcagtcatcgtatgtcgcgtgtgcaaatcattacaa |
30565073 |
T |
|
| Q |
489 |
aaatg |
493 |
Q |
| |
|
||||| |
|
|
| T |
30565074 |
aaatg |
30565078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 400 - 483
Target Start/End: Original strand, 7642440 - 7642523
Alignment:
| Q |
400 |
acctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
7642440 |
acctttttaaaaatcaaaagattttacagggactatttttctaataaatgagttcagtcatcatgtgccacgtgtgcaaatcat |
7642523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 47022880 - 47022975
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
47022880 |
tattttgcagagacctttttcaaaattaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
47022975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 53307979 - 53307884
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| | ||||| |||||| |||| ||||||| |
|
|
| T |
53307979 |
tattttgcaagaacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcggttatcatatgtcacgtgtgtaaatcat |
53307884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 23245597 - 23245536
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
23245597 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgtaaa |
23245536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 13530714 - 13530654
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13530714 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
13530654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 24774044 - 24774104
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24774044 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
24774104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 26412187 - 26412243
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26412187 |
ataggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccc |
26412243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 29499322 - 29499413
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
29499322 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
29499413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 30060993 - 30060902
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
30060993 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
30060902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 31560555 - 31560464
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||| ||||| |
|
|
| T |
31560555 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtacaaat |
31560464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 35464158 - 35464249
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
35464158 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
35464249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 42848167 - 42848258
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| ||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
42848167 |
tattttgcagggacctttttcaaaatcaaaagattttgcaaggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
42848258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 43231390 - 43231330
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43231390 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
43231330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 53915907 - 53915816
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
53915907 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
53915816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 12152268 - 12152363
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||| |||| |||||||| |||| ||||| |||| ||| ||||||||||| |
|
|
| T |
12152268 |
tattttgcagggacctttttaaaaatcaaaagattttgcagagactatctttctaataaatgagttcagtcatcgtgtgccacgagtgcaaatcat |
12152363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 41324890 - 41324831
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgtaaa |
41324831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 46115414 - 46115473
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
46115473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 46128548 - 46128607
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
46128607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 47136002 - 47135908
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||| || ||| |||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
47136002 |
tattttacagggatctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaatcat |
47135908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 29499181 - 29499235
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29499181 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
29499235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 30046793 - 30046739
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30046793 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
30046739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 30061134 - 30061080
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30061134 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
30061080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 31560330 - 31560384
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31560330 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccc |
31560384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 31812127 - 31812053
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||| ||||||||||| || ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
31812127 |
aaaatcaaaagattttggagggactatttctctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
31812053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 13631226 - 13631287
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
13631226 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
13631287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 14487800 - 14487861
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
14487800 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaaa |
14487861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 23245231 - 23245284
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
23245284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 35464016 - 35464077
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
35464016 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
35464077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 35464382 - 35464329
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
35464329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 42848391 - 42848338
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
42848338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 2322433 - 2322373
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
2322433 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgtaaa |
2322373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 13064466 - 13064406
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13064466 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
13064406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 16712692 - 16712632
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16712692 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
16712632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 23245455 - 23245364
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| ||||||||| || ||||||||| |||| |||||||||| || ||||||||| |
|
|
| T |
23245455 |
tattttgcagggacctttttcaaaatcaaaagattttgcaaggactatttctctaataaatgg-ttcagtcatcatgtgacatgtgtgcaaat |
23245364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 25423923 - 25423983
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
25423923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
25423983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 25424313 - 25424253
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
25424313 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
25424253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 26412360 - 26412451
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| ||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
26412360 |
tattttgcagggacctttttcaaaatcaaaagattttgcatggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
26412451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 44925484 - 44925536
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44925484 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 52017504 - 52017564
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52017504 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
52017564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 52017871 - 52017811
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52017871 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
52017811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 53915680 - 53915736
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
53915680 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccc |
53915736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 4211559 - 4211614
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4211559 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccc |
4211614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 5827974 - 5827915
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
5827974 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgtaa |
5827915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 11692986 - 11692891
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||| | ||||||||| ||||||||| |||| |||||||||| ||| | || ||||||| |
|
|
| T |
11692986 |
tattttgcagagaactttttaaaaatcaaaagattttgcagaggctatttttctaataaatgggttcagtcatcatgtgccacgtatgaaaatcat |
11692891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 11693125 - 11693062
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
11693125 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgtaaa |
11693062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 13073759 - 13073818
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
13073818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 319
Target Start/End: Original strand, 20291982 - 20292037
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20291982 |
aataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
20292037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 26314214 - 26314120
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || ||||||||||| ||||||||| |||| ||||||| | || ||||||||||||| |
|
|
| T |
26314214 |
tattttgca-ggacctttttaaaaatcaaaagattttacaaggactatttttgtaataaatgggttcagtcatcatattgcagatgtgcaaatcat |
26314120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 26314333 - 26314274
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||| |
|
|
| T |
26314333 |
aggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgtaa |
26314274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 29420539 - 29420484
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
29420539 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
29420484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 31811924 - 31811983
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
31811924 |
aggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgtaa |
31811983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 35763645 - 35763700
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35763645 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
35763700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 41440012 - 41439918
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||| |||||||||||||||| |||||||| || ||||||||| ||||| ||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
41440012 |
tattttgcagggac-tttttaaaaatcaaaaaattttgcaaggtctatttttctaataattgggttcagtcatcatgtgccacgtgtgcaaatcat |
41439918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 43200194 - 43200100
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||| ||||| ||||| ||| ||||||||||||| ||||| || ||||||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
43200194 |
tattttgcaaggacttttttcaaaattaaa-gattttgcagggattatttctctaataaatgggttcagtcatcatatgtcacatgtgcaaatcat |
43200100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 47023107 - 47023052
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47023107 |
taggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccc |
47023052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 54208601 - 54208695
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||||||||||| |||| |||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
54208601 |
tattttgcaaggacctttttgaaaatgaaaagattttgca-ggacaatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
54208695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 54903476 - 54903417
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
54903476 |
aggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
54903417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 269 - 327
Target Start/End: Complemental strand, 6353637 - 6353579
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaaa |
6353579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 13074127 - 13074073
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
13074127 |
taggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
13074073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 13631600 - 13631546
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
13631600 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccc |
13631546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 14791807 - 14791753
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
14791807 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
14791753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 18205155 - 18205209
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18205155 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
18205209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 29499543 - 29499493
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
29499493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 32208541 - 32208595
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32208541 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
32208595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 32208902 - 32208848
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32208902 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccc |
32208848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 41345852 - 41345906
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41345852 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
41345906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 253 - 327
Target Start/End: Original strand, 42848012 - 42848086
Alignment:
| Q |
253 |
atatcagttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||| |||| | ||||||||||||||||||| | |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
42848012 |
atatcattttttaaaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaaa |
42848086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 43231087 - 43231141
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
43231087 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
43231141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 265 - 327
Target Start/End: Complemental strand, 51545972 - 51545910
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51545972 |
ataggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
51545910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 268 - 326
Target Start/End: Complemental strand, 53717174 - 53717116
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
53717116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 264 - 318
Target Start/End: Complemental strand, 53916051 - 53915997
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
53916051 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
53915997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 123530 - 123587
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
123530 |
aataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 13064157 - 13064218
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
13064157 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaa |
13064218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 13479613 - 13479552
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
13479613 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
13479552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 13530375 - 13530432
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
13530375 |
aataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccc |
13530432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 14488189 - 14488128
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
14488189 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaa |
14488128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 26412584 - 26412531
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccc |
26412531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 35415633 - 35415580
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
35415580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 46292392 - 46292445
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccc |
46292445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 398 - 483
Target Start/End: Original strand, 51762987 - 51763072
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||| | ||||||||||||||||||| | ||||||| || ||||||||| |||| ||||||| |||||| |||||||||||| |
|
|
| T |
51762987 |
ggacctttctcaaaatcaaaagattttgcatgaactatttctctaataaatgggttcagtcatcatttgtcacgtgtgcaaatcat |
51763072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 2180219 - 2180279
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
2180219 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
2180279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 9289263 - 9289319
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
9289263 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
9289319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 12152495 - 12152435
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
12152495 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgtaa |
12152435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 12791976 - 12791916
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12791976 |
taggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgtaa |
12791916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 13631375 - 13631466
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||||||||||| ||||||||| || ||||||||| ||| |||||||||| ||| ||||||||| |
|
|
| T |
13631375 |
tattttgcagggacctttttcaaaatgaaaagattttgcaaggactatttctctaataaatgg-ttcggtcatcatgtgccacgtgtgcaaat |
13631466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 22099543 - 22099595
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22099595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 260 - 320
Target Start/End: Complemental strand, 29380918 - 29380858
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
29380918 |
ttttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
29380858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 29463914 - 29463854
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
29463914 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaaa |
29463854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 30060766 - 30060822
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
30060766 |
ataggttaaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccc |
30060822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 31812214 - 31812154
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
31812214 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaaa |
31812154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 318
Target Start/End: Original strand, 32365092 - 32365144
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32365092 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32365144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 36054151 - 36054091
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
36054151 |
aggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaa |
36054091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 448
Target Start/End: Original strand, 37556976 - 37557036
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaat |
448 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
37556976 |
tattttgcaaagacctttttaaaaatcagaagattttgcagggactatttttctaataaat |
37557036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 38054549 - 38054605
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
38054605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 55072388 - 55072448
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
55072388 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
55072448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 2034856 - 2034797
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
2034856 |
aggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgtaa |
2034797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 5827655 - 5827714
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaa |
5827714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 409 - 480
Target Start/End: Complemental strand, 19321773 - 19321703
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||| ||||||||||||||||||||||| || ||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
19321773 |
aaaatgaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgtcacgtgtgcaaat |
19321703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 19321859 - 19321800
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaa |
19321800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 318
Target Start/End: Original strand, 23778963 - 23779014
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23778963 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 420 - 483
Target Start/End: Complemental strand, 29380801 - 29380738
Alignment:
| Q |
420 |
attttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
29380801 |
attttggagggactatttttctaataaatggattcagtcatcatgtgccacgtgtgcaaatcat |
29380738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 31560695 - 31560636
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaa |
31560636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 35119291 - 35119350
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
35119291 |
aggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgtaa |
35119350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 41619897 - 41619952
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41619897 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
41619952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 318
Target Start/End: Complemental strand, 45505895 - 45505844
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45505895 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
45505844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 46088062 - 46088007
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
46088062 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
46088007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 327
Target Start/End: Original strand, 52441759 - 52441822
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
52441759 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaa |
52441822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 53308068 - 53308009
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgtaaa |
53308009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 260 - 327
Target Start/End: Complemental strand, 55072720 - 55072653
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| ||||| |||||||||||||| |||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
55072720 |
tttttataggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaa |
55072653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 273 - 327
Target Start/End: Original strand, 2034544 - 2034598
Alignment:
| Q |
273 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
2034598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 2322094 - 2322152
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgtaaa |
2322152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 6827875 - 6827821
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6827875 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccc |
6827821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 11285504 - 11285562
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
11285562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 12152151 - 12152213
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
12152151 |
ataggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgtaaa |
12152213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 13530583 - 13530509
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||| |||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
13530583 |
aaaaacaaaatattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
13530509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 13764613 - 13764671
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||| |||||| |||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgtaa |
13764671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 388 - 466
Target Start/End: Original strand, 14594342 - 14594420
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtg |
466 |
Q |
| |
|
||||||||| ||| |||||||| ||| || |||||||||| ||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
14594342 |
tattttgcagggatctttttaagaataaagagattttgcatagactatttttctaataaatggattcactcatcatgtg |
14594420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 15555506 - 15555556
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
15555556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 264 - 326
Target Start/End: Original strand, 19903257 - 19903319
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||| ||||| |||||||||| |||| |
|
|
| T |
19903257 |
aataggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgtaa |
19903319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 320
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19903603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 23779226 - 23779172
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
23779226 |
aggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccc |
23779172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 24474964 - 24474910
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
24474964 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
24474910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 26313988 - 26314046
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgtaa |
26314046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 28809181 - 28809127
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28809181 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccc |
28809127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 32365484 - 32365430
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
32365484 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccc |
32365430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 269 - 327
Target Start/End: Complemental strand, 44925844 - 44925786
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgtaaa |
44925786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 45505599 - 45505653
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45505599 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccc |
45505653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 46292536 - 46292462
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||| | ||||||||| | |||||||||||||| |||||||||||| |
|
|
| T |
46292536 |
aaaaacaaaatattttgcagggactatttttctacaaaatggatttagtcatcatgtgtcacgtgtgcaaatcat |
46292462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 51738134 - 51738196
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
51738134 |
ataggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgtaaa |
51738196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 5052585 - 5052532
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5052585 |
aggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
5052532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 5882550 - 5882610
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5882550 |
taggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgtaaa |
5882610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 316
Target Start/End: Original strand, 8904885 - 8904934
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8904885 |
aggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 9445951 - 9446008
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
9446008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 392 - 481
Target Start/End: Original strand, 11219473 - 11219562
Alignment:
| Q |
392 |
ttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatc |
481 |
Q |
| |
|
||||| |||||||||| ||||| |||||||| | |||||||||||| || ||||||| ||| || ||||||| |||||| |||||||||| |
|
|
| T |
11219473 |
ttgcaaggacctttttcaaaattaaaagattatccagggactatttctctaataaatagatccagtcatcatttgtcacgtgtgcaaatc |
11219562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 392 - 481
Target Start/End: Original strand, 11229980 - 11230069
Alignment:
| Q |
392 |
ttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatc |
481 |
Q |
| |
|
||||| |||||||||| ||||| |||||||| | |||||||||||| || ||||||| ||| || ||||||| |||||| |||||||||| |
|
|
| T |
11229980 |
ttgcaaggacctttttcaaaattaaaagattatccagggactatttctctaataaatagatccagtcatcatttgtcacgtgtgcaaatc |
11230069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 319
Target Start/End: Original strand, 16712331 - 16712380
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtc |
16712380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 27008084 - 27008137
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
27008137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 34361802 - 34361855
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
34361802 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34361855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 36050289 - 36050346
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| |||||||||||||||||||| |||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgtaa |
36050346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 418 - 483
Target Start/End: Complemental strand, 36050481 - 36050416
Alignment:
| Q |
418 |
agattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| ||||||| || ||| |||||||||||| |
|
|
| T |
36050481 |
agattttgcagggactatttttctaataaatgggttcagtcatcatatgccacgtgtgcaaatcat |
36050416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 37557194 - 37557137
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||| |||||||||| |||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgtaa |
37557137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 42823774 - 42823835
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
42823774 |
taggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgtaaa |
42823835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 50714240 - 50714293
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
50714293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 50714565 - 50714512
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
50714512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 51708691 - 51708744
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
51708691 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 52430102 - 52430041
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
52430102 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaa |
52430041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 6827545 - 6827597
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
6827545 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 8760603 - 8760663
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
8760603 |
aggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgtaaa |
8760663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 8760782 - 8760722
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
8760782 |
aggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgtaaa |
8760722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 319
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 18136114 - 18136054
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18136114 |
aggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgtaaa |
18136054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 415 - 483
Target Start/End: Complemental strand, 20144617 - 20144549
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||| ||| |||||| ||||| |
|
|
| T |
20144617 |
aaaagattttgcagggactatttttctaataaatgagttcaatcatcatgtaccacgtgtgcatatcat |
20144549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Complemental strand, 22099913 - 22099861
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
22099913 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22099861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 263 - 319
Target Start/End: Original strand, 22584282 - 22584338
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
22584282 |
taataggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
22584338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 31182505 - 31182445
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||||| |||||| ||||| |
|
|
| T |
31182505 |
aggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgtaaa |
31182445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 35415296 - 35415352
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
35415296 |
ataggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccc |
35415352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 35763958 - 35763902
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
35763958 |
ataggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccc |
35763902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Complemental strand, 46292652 - 46292600
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
46292652 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 49123322 - 49123262
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49123322 |
aggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgtaaa |
49123262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 51545628 - 51545680
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
51545628 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
51545680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Complemental strand, 51709028 - 51708976
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
51709028 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 52442093 - 52442033
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
52442093 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaaa |
52442033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54208774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 5202929 - 5202980
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcg-ttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccc |
5202980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 8191391 - 8191332
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaaa |
8191332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 9289641 - 9289586
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
9289641 |
taggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
9289586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 11692760 - 11692815
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
11692760 |
taggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccc |
11692815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 19321568 - 19321623
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
19321568 |
taggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccc |
19321623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 271 - 326
Target Start/End: Original strand, 20144423 - 20144478
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctgtaa |
20144478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 34355287 - 34355224
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
34355287 |
aataggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgtaaa |
34355224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 320
Target Start/End: Complemental strand, 35119614 - 35119559
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| ||||||||||||| ||||| |
|
|
| T |
35119614 |
ataggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 36701999 - 36702058
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |||||||||| |||| |
|
|
| T |
36701999 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
36702058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 388 - 439
Target Start/End: Original strand, 44925624 - 44925675
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactattttt |
439 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
44925624 |
tattttgcagggacctttttaaaaattaaaagattttgcaaggactattttt |
44925675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 269 - 320
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
47136119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 51738413 - 51738358
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |||| ||||| |
|
|
| T |
51738413 |
taggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccc |
51738358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 320
Target Start/End: Original strand, 53716918 - 53716973
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
53716918 |
ataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
53716973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 55482468 - 55482409
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgtaaa |
55482409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 14594204 - 14594258
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
14594204 |
taggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 273 - 327
Target Start/End: Complemental strand, 27008401 - 27008347
Alignment:
| Q |
273 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaa |
27008347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 27427871 - 27427924
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| | |||||||||||||| |||||||||||||||||||| |
|
|
| T |
27427871 |
aggctaaaatatggtttag-tccctgcaaatatggctcgttttggttttagtccc |
27427924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 269 - 327
Target Start/End: Complemental strand, 36702362 - 36702304
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| | |||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgtaaa |
36702304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 41346220 - 41346166
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
41346220 |
taggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
41346166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 41620257 - 41620203
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
41620257 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccc |
41620203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 46115780 - 46115726
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
46115780 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccc |
46115726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 46128914 - 46128860
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
46128914 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccc |
46128860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 47022743 - 47022793
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccc |
47022793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 269 - 327
Target Start/End: Complemental strand, 51763201 - 51763143
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||| ||||||||||||| || ||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgtaaa |
51763143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 273 - 322
Target Start/End: Complemental strand, 123893 - 123844
Alignment:
| Q |
273 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagtcccc |
322 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtcccc |
123844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 13764808 - 13764755
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
13764808 |
aggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 270 - 327
Target Start/End: Complemental strand, 18205521 - 18205464
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaa |
18205464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 316
Target Start/End: Complemental strand, 20144732 - 20144683
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
20144732 |
aggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 22584609 - 22584548
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
22584609 |
taggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgtaaa |
22584548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 25358540 - 25358487
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccc |
25358487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 28448832 - 28448885
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
28448832 |
taggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 35420387 - 35420444
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||||||| | ||||||||||||||||| |
|
|
| T |
35420387 |
aatagtctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccc |
35420444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 43368467 - 43368524
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaa |
43368524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 45593226 - 45593287
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
45593226 |
taggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgtaaa |
45593287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 45593588 - 45593527
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
45593588 |
taggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgtaaa |
45593527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 316
Target Start/End: Original strand, 52543421 - 52543470
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
52543421 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 4279335 - 4279283
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtcc |
4279283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 5797484 - 5797540
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||| ||||| || ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgtaaa |
5797540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 5797823 - 5797767
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||| ||||||||||||||| |||| |
|
|
| T |
5797823 |
ataggttaaaatatggttttggtccctacaaatatgtctcgttttggttttaatccc |
5797767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 269 - 321
Target Start/End: Original strand, 13479273 - 13479325
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccc |
13479325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 316
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 262 - 318
Target Start/End: Original strand, 31370798 - 31370854
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||||||||| | |||| |||||||||||||||||||||||| |
|
|
| T |
31370798 |
ttaataggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 270 - 326
Target Start/End: Complemental strand, 35420701 - 35420645
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgtaa |
35420645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 42824091 - 42824039
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||| ||||||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc |
42824039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 319
Target Start/End: Complemental strand, 45474597 - 45474545
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45474597 |
aggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc |
45474545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 415 - 475
Target Start/End: Original strand, 50754058 - 50754118
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtg |
475 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||| |||||||||||||| |||| |
|
|
| T |
50754058 |
aaaatattttgcagggactatttttctaataaatgagttcagtcatcatgtgtcacgtgtg |
50754118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 51762869 - 51762929
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||| || |||||||||||| || |||||||||||||||| ||||| |
|
|
| T |
51762869 |
aggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgtaaa |
51762929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 4279020 - 4279075
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
4279020 |
taggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccc |
4279075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 28809011 - 28809070
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgtaaa |
28809070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 47532675 - 47532613
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| |||||||||| ||| |||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
47532675 |
aataggctaaa-tatggttttggtccttgcaaatatgtctcgttttggttttagttcctgtaaa |
47532613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 319
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 265 - 327
Target Start/End: Complemental strand, 18831181 - 18831119
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||| || ||||||||||||||||| ||||| |
|
|
| T |
18831181 |
atagactaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgtaaa |
18831119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 29380667 - 29380721
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
29380667 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccc |
29380721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 8905234 - 8905181
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| ||||| ||||| |||| |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccc |
8905181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 24474599 - 24474651
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 267 - 316
Target Start/End: Complemental strand, 28449215 - 28449166
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||| ||||| |
|
|
| T |
28449215 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 405 - 450
Target Start/End: Complemental strand, 35420588 - 35420543
Alignment:
| Q |
405 |
tttaaaaatcaaaagattttgcagggactatttttcaaataaatgg |
450 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
35420588 |
tttaaaaatcaaaatattttgcagagactatttttctaataaatgg |
35420543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 41921085 - 41921032
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
41921085 |
aggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 271 - 316
Target Start/End: Original strand, 54903114 - 54903159
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
54903114 |
taaaatatggttttgatccctacaaatatgcatcgttttagtttta |
54903159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 2180572 - 2180520
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtcc |
2180520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 36050359 - 36050399
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccc |
36050399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 266 - 326
Target Start/End: Original strand, 37556839 - 37556899
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| || ||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
37556839 |
taggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgtaa |
37556899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #249
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 260 - 327
Target Start/End: Complemental strand, 43368786 - 43368718
Alignment:
| Q |
260 |
ttttaata-ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||| ||||||||||||||||| || || ||||||||| |||||||||||||||| || ||||| |
|
|
| T |
43368786 |
ttttaatatggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctgtaaa |
43368718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #250
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 50753925 - 50753981
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||||||||||||| || |||||||||||||| || ||||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgtaaa |
50753981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #251
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 50754258 - 50754198
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || |||||| |||||||||||| |||| |
|
|
| T |
50754258 |
taggctaaaatatggttttgatcactgcaaacatatatcgtttaggttttagtccctgtaa |
50754198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #252
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 287 - 327
Target Start/End: Original strand, 54208480 - 54208520
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
54208480 |
tccctgcaaatatgcctcattttggttttagtccctgtaaa |
54208520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #253
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 55805088 - 55805036
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||| |||||| | | ||||||||||||| |||||||||||||||| |
|
|
| T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc |
55805036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #254
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 7639897 - 7639944
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| || |||||||||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
7639944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #255
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 9446323 - 9446264
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgtaaa |
9446264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #256
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 20878927 - 20878884
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
20878927 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
20878884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #257
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 23254518 - 23254561
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
23254518 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
23254561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #258
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 269 - 320
Target Start/End: Original strand, 25358213 - 25358264
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||| |||||||||||| ||||| |
|
|
| T |
25358213 |
gctaaaatatgattttaatccatgcaaatatgcttcgttttggtttcagtcc |
25358264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #259
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 270 - 321
Target Start/End: Original strand, 30564835 - 30564886
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccc |
30564886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #260
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 269 - 320
Target Start/End: Original strand, 30890832 - 30890883
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || |||| |||||||||| |
|
|
| T |
30890832 |
gctaaaatatggttatgatccctgcaaatatgtcttattttagttttagtcc |
30890883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #261
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 42306138 - 42306095
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
42306138 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
42306095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #262
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 45593447 - 45593404
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
45593447 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
45593404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #263
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 2034781 - 2034739
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccccg |
323 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
2034781 |
ttttggtccctgcaaatatgtctcattttggttttagtccccg |
2034739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #264
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 432
Target Start/End: Original strand, 2180352 - 2180394
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
2180352 |
ttttgcagggacctttttaaaaaacaaaatattttgcagggac |
2180394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #265
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 268 - 326
Target Start/End: Complemental strand, 7642652 - 7642594
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||| || || || ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctgtaa |
7642594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #266
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 8191076 - 8191134
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| |||| |||||| |||||||| || ||||| ||||||||||| ||||| |
|
|
| T |
8191076 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgtaaa |
8191134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #267
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 266 - 300
Target Start/End: Original strand, 33134889 - 33134923
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatg |
300 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
33134889 |
taggctaaaatatgtttttgatccctgcaaatatg |
33134923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #268
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 33137288 - 33137234
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| | |||| |||||||||||| |
|
|
| T |
33137288 |
aggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttagtccc |
33137234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #269
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 268 - 318
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||| ||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #270
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 270 - 316
Target Start/End: Complemental strand, 52543725 - 52543679
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggtttta |
52543679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #271
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 299
Target Start/End: Original strand, 3879084 - 3879117
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
3879084 |
taggctaaaatatgcttttgatccctgcaaatat |
3879117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #272
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 267 - 300
Target Start/End: Original strand, 9836831 - 9836864
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatg |
300 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
9836831 |
aggctaaaatatggttttgatccttgcaaatatg |
9836864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #273
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 51830891 - 51830948
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||| ||||| |||||||| ||||| || ||||||||||||||||| ||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctgtaaa |
51830948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #274
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 5797747 - 5797707
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
5797747 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
5797707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #275
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 5827728 - 5827768
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| ||||| |
|
|
| T |
5827728 |
ttttgatccctgaaaatatgtctcgttttggttttggtccc |
5827768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #276
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 388 - 432
Target Start/End: Complemental strand, 9289486 - 9289442
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||||| |||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
9289486 |
tattttgcagggaccttttttaaaaacaaaatattttgcagggac |
9289442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #277
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 11692834 - 11692874
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| ||||| |
|
|
| T |
11692834 |
ttttggtccctgcaaatatgcctcgttttgattttggtccc |
11692874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #278
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 13530452 - 13530492
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
13530452 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
13530492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #279
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 14594494 - 14594454
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
14594494 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
14594454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #280
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 19903334 - 19903374
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
19903334 |
ttttgatccctgcaaatatgtctcattttggttttggtccc |
19903374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #281
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 20144492 - 20144532
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
20144492 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
20144532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #282
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 272 - 320
Target Start/End: Complemental strand, 20292284 - 20292237
Alignment:
| Q |
272 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||| |||||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
20292284 |
aaaatatcgttttggtccctgcaa-tatgcctcattttggttttagtcc |
20292237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #283
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 24774354 - 24774314
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
24774354 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
24774314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #284
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 25424239 - 25424199
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
25424239 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
25424199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #285
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 31811996 - 31812036
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
31811996 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
31812036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #286
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 47135851 - 47135891
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
47135851 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
47135891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #287
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 50822295 - 50822235
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||| | ||| |||||||||| ||||| |
|
|
| T |
50822295 |
aggctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtccctgtaaa |
50822235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #288
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 415 - 483
Target Start/End: Original strand, 51738273 - 51738341
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| |||||||||||| | |||||| ||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
51738273 |
aaaatattttgcagggagtgtttttctaataaataagttcagtcatcatgtgccacgtgtgcaaatcat |
51738341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #289
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 51763129 - 51763089
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
51763129 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
51763089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #290
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 54903403 - 54903363
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
54903403 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
54903363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 72; Significance: 2e-32; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 16948 - 16853
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
16948 |
tattttgcagagacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacatgtgcaaatcat |
16853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 16724 - 16782
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgtaa |
16782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 2e-32; HSPs: 249)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 14848050 - 14847955
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||| |||||| ||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
14848050 |
tattttgcagggacgtttttacaaatcaaaagattttgcagggactatttttctaataaatgggttcactcatcatgtgtcacatgtgcaaatcat |
14847955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 24090344 - 24090249
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||||| ||||| |
|
|
| T |
24090344 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcggtcatcatgtgtcacatgtgcatatcat |
24090249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 28497479 - 28497384
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
28497479 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
28497384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 1778789 - 1778694
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || |||||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
1778789 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatggattcagtcatcatgtgccacgtgtgcaaatcat |
1778694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 9175147 - 9175242
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| || |||||||||||| |
|
|
| T |
9175147 |
tattttgcagggacctttctaaaaatcaaaagattttgcagggactatttttcaaataaatgggttcagtcatcatgtgccatgtgtgcaaatcat |
9175242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 13232423 - 13232328
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
13232423 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
13232328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 15931044 - 15931139
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
15931044 |
tattttgcaggcacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgacacgtgtgcaaatcat |
15931139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 29992076 - 29992171
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||| |||||||||||||| |||| ||||||| |
|
|
| T |
29992076 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggattattttttaaataaatgggttcagtcatcatgtgtcacgtgtgtaaatcat |
29992171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 2356110 - 2356015
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||| |||||||| ||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
2356110 |
tattttgcaaggatctttttaaaaatcaaaagattttgcagggattatttttctaataaatgggttcagtcatcatgtgtcatgtgtgcaaatcat |
2356015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 8298812 - 8298717
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
8298812 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
8298717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 23939772 - 23939677
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||| || |||||||| |||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
23939772 |
tattttgcagggacttttttaaaaatcaaaagattttgcagtgattatttttctaataaatgagttcagtcatcatgtgtcacatgtgcaaatcat |
23939677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 388 - 493
Target Start/End: Original strand, 42429895 - 42430000
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataacc |
487 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||| | ||||||| |||| |||||||||| ||| |||||||||||| || |
|
|
| T |
42429895 |
tattttgccgggatctttttaaaaatcaaaagattttgcagggactatttttctattaaatgggttcagtcatcatgtgccacgtgtgcaaatcatcaca |
42429994 |
T |
|
| Q |
488 |
aaaatg |
493 |
Q |
| |
|
|||||| |
|
|
| T |
42429995 |
aaaatg |
42430000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 399 - 483
Target Start/End: Original strand, 35115485 - 35115569
Alignment:
| Q |
399 |
gacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||| |||||||||||||| | |||||||||| |
|
|
| T |
35115485 |
gacctttttaaaaatcaaaagattttgcaaggactatttttctaataaatgggttcagtcatcatgtgtcacgtatgcaaatcat |
35115569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 4473929 - 4473834
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| |||||||||||| |
|
|
| T |
4473929 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggtttagtcatcatgtgccacgtgtgcaaatcat |
4473834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 7420455 - 7420360
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
7420455 |
tattttgcagggacctttttcaaaatcaaaagattttgcagagactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
7420360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 30969534 - 30969628
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || ||||||||||| |||||| || |||||||||||||||||| ||||||||||||| |
|
|
| T |
30969534 |
tattttgcagggacctttttaaaaatcaaaagattttt-agcgactatttttctaataaacgggttcaatcatcatgtgtcatatgtgcaaatcat |
30969628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 392 - 483
Target Start/End: Original strand, 36044570 - 36044661
Alignment:
| Q |
392 |
ttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
36044570 |
ttgcagggacctttttaaaaatcaaaagattttgcagggactatttttgtaataaataagttcagtcatcatgtatcacatgtgcaaatcat |
36044661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 44998040 - 44998135
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||| || | |||||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
44998040 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactacttctataataaatggattcagtcatcatgtgccacgtgtgcaaatcat |
44998135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 393 - 483
Target Start/End: Complemental strand, 7326306 - 7326216
Alignment:
| Q |
393 |
tgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
7326306 |
tgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
7326216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 391 - 493
Target Start/End: Original strand, 9832336 - 9832438
Alignment:
| Q |
391 |
tttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataaccaaa |
490 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||| |||||||||| ||||||||| | || |||||||||| |||||||| ||||||| || ||| |
|
|
| T |
9832336 |
tttgcagggaccttttcaaaaatcaaaagattttgcaggtactatttttctaataaatgggtacattcatcatgtgccacatgtgtaaatcatcacaaaa |
9832435 |
T |
|
| Q |
491 |
atg |
493 |
Q |
| |
|
||| |
|
|
| T |
9832436 |
atg |
9832438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 388 - 482
Target Start/End: Complemental strand, 13155111 - 13155017
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatca |
482 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
13155111 |
tattttgcagggatctttttaaaaatcaaaagattttgtagggactattttcttaataaatggattcagtcatcatgtgccacgtgtgcaaatca |
13155017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 388 - 486
Target Start/End: Complemental strand, 24814930 - 24814832
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataac |
486 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||| |||||||||||||| | |||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
24814930 |
tattttgcagggacctttttaaaaatcaatagattttatagggactatttttctattaaatggattcagtcatcatgtgctacgtgtgcaaatcataac |
24814832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 4474045 - 4473985
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4474045 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaaa |
4473985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 10872914 - 10872974
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10872914 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaaa |
10872974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 10873055 - 10873151
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaat-aaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||| |||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
10873055 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
10873151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 20984370 - 20984279
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
20984370 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
20984279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 17073943 - 17074038
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||||||||||| || ||| ||||||||||||||||| |||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
17073943 |
tattttgcaaggatctttttaaaaatcagaatattatgcagggactatttttctaataaatgagttcagtcatcatgtgtcacgtgtgcaaatcat |
17074038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 17574327 - 17574232
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||||||||||| || ||| ||||||||||||||||| |||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
17574327 |
tattttgcaaggatctttttaaaaatcagaatattatgcagggactatttttctaataaatgagttcagtcatcatgtgtcacgtgtgcaaatcat |
17574232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 400 - 483
Target Start/End: Original strand, 28323969 - 28324052
Alignment:
| Q |
400 |
acctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||| ||| |||| ||||||| |
|
|
| T |
28323969 |
acctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcaatcatcatgtgccacgtgtgtaaatcat |
28324052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 2728373 - 2728464
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
2728373 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
2728464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 3512042 - 3512133
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
3512042 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
3512133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 4710130 - 4710039
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
4710130 |
tattttgcaaggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
4710039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 11019744 - 11019653
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
11019744 |
tattttgcaaggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
11019653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 11976372 - 11976432
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11976372 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
11976432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 11976512 - 11976603
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
11976512 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
11976603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 32726047 - 32726138
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
32726047 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
32726138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 34963524 - 34963433
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
34963524 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
34963433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 35097468 - 35097559
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
35097468 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
35097559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 35346853 - 35346762
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
35346853 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
35346762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 4710222 - 4710167
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4710222 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
4710167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 7326421 - 7326362
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
7326362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 11019859 - 11019804
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019859 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
11019804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 13779311 - 13779405
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||||||| |||||||||||||||||||||||||||| |||||||| |||| || |||||| |||||||||||||||| |
|
|
| T |
13779311 |
tattttgcagggatctttttaaaa-tcaaaagattttgcagggactatttttctaataaatgagttcagtctacatgtgccacatgtgcaaatcat |
13779405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 13796461 - 13796366
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||||||||||||||||||||| |||||||| || | ||||||||| |||| |||| ||||||| |
|
|
| T |
13796461 |
tattttgcaggaacctttttaaaaattaaaagattttgcagggactatttttctaataaatgagtttagtcatcatgtatcacgtgtgtaaatcat |
13796366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 23360596 - 23360501
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||| | |||||||||| | |||| | |||||||||||| || |||||||||||||||| |
|
|
| T |
23360596 |
tattttgcagggacctttttaaaaatcaaaatattttgcaagaactatttttctacaaaataggttcaatcatcatatgccacatgtgcaaatcat |
23360501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 260 - 327
Target Start/End: Original strand, 25600222 - 25600289
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
25600222 |
ttttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgtaaa |
25600289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 25600456 - 25600361
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||||||||| || |||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
25600456 |
tattttgcagggacaattttcaaaatcaaaagattttgcagggactatttctctaataaatgagttcagtcatcatgtgtcatgtgtgcaaatcat |
25600361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 28346760 - 28346705
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28346760 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
28346705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 32726273 - 32726218
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726273 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
32726218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 388 - 458
Target Start/End: Original strand, 3680668 - 3680738
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatc |
458 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||| |
|
|
| T |
3680668 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaaaaaatgagttcaatc |
3680738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 398 - 480
Target Start/End: Original strand, 10337235 - 10337316
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
10337235 |
ggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
10337316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 28346393 - 28346447
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28346393 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
28346447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 34963299 - 34963353
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34963299 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
34963353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 37536085 - 37536139
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37536085 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
37536139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 2728597 - 2728544
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
2728544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 5357419 - 5357476
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5357419 |
aataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccc |
5357476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 10337117 - 10337178
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
10337117 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
10337178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 398 - 483
Target Start/End: Complemental strand, 10540663 - 10540579
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| || ||||||||| ||| | ||||||||| ||| |||||||||||| |
|
|
| T |
10540663 |
ggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttc-agcatcatgtgccacgtgtgcaaatcat |
10540579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 265 - 326
Target Start/End: Original strand, 13154883 - 13154944
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13154883 |
ataggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgtaa |
13154944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 35097324 - 35097381
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
35097324 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
35097381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 35097692 - 35097639
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
35097639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 264 - 321
Target Start/End: Complemental strand, 35347002 - 35346945
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
35347002 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
35346945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 7326083 - 7326139
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7326083 |
ataggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccc |
7326139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 7420591 - 7420531
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7420591 |
aggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaaa |
7420531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 8298976 - 8298916
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
8298976 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
8298916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 9496499 - 9496590
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
9496499 |
tattttgcagggacctttttcaaaatgaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
9496590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 10540783 - 10540723
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
10540783 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
10540723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 20984145 - 20984205
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
20984145 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaa |
20984205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 263 - 319
Target Start/End: Complemental strand, 24090493 - 24090437
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24090493 |
taatacgctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24090437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 24187568 - 24187628
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
24187568 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgtaaa |
24187628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 25702645 - 25702736
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||||||||||| ||||||||| || ||||||| |||||| |||||||||| ||| ||||||||| |
|
|
| T |
25702645 |
tattttgcagggacctttttcaaaatgaaaagattttgcacggactatttctctaataaat-gattcagtcatcatgtgccacgtgtgcaaat |
25702736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 27341592 - 27341532
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27341592 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
27341532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 28346534 - 28346625
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||||||||||||||||||||| || ||||||| | || | |||||||||| ||||||||||||| |
|
|
| T |
28346534 |
tattttgcagggacctttttcaaaataaaaagattttgcagggactatttctctaataaatag-ttaagtcatcatgtgacacatgtgcaaat |
28346625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 43477162 - 43477222
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43477162 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
43477222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 262 - 321
Target Start/End: Original strand, 1778558 - 1778617
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
1778558 |
ttaattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
1778617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 3511904 - 3511959
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3511904 |
taggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccc |
3511959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 3512268 - 3512213
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
3512268 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
3512213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 412 - 483
Target Start/End: Original strand, 4621153 - 4621224
Alignment:
| Q |
412 |
atcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||| |||| ||||||||||| || |||||||||||| |
|
|
| T |
4621153 |
atcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgtgacgtgtgcaaatcat |
4621224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 4621354 - 4621295
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
4621295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 8298587 - 8298646
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
8298646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 10337451 - 10337396
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10337451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccc |
10337396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 14489073 - 14489014
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
14489014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 16789369 - 16789310
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
16789310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 20277691 - 20277750
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
20277691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaa |
20277750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 20277917 - 20277822
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||| |||| | |||||||| ||| ||| |||||||| |
|
|
| T |
20277917 |
tattttgcaggttcctttttaaaaatcaaaagattttgcagggactatttttttaataaatgagttcagttatcatgtgccacgtgttcaaatcat |
20277822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 21064318 - 21064377
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
21064318 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaa |
21064377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 21064544 - 21064449
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||| |||| | |||||||| ||| ||| |||||||| |
|
|
| T |
21064544 |
tattttgcaggttcctttttaaaaatcaaaagattttgcagggactatttttttaataaatgagttcagttatcatgtgccacgtgttcaaatcat |
21064449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 29992304 - 29992241
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
29992304 |
aataggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgtaaa |
29992241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 323
Target Start/End: Original strand, 33636318 - 33636377
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccg |
323 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33636318 |
aataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccccg |
33636377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 42133154 - 42133095
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
42133095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 3680802 - 3680748
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3680802 |
aggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccc |
3680748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 268 - 326
Target Start/End: Complemental strand, 7186004 - 7185946
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
7185946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 7420229 - 7420283
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
7420229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
7420283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 9496724 - 9496670
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9496724 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
9496670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 11019519 - 11019573
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
11019519 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
11019573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 14239081 - 14239027
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14239081 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
14239027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 19494414 - 19494360
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
19494360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 20278059 - 20278005
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
20278059 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
20278005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 21064686 - 21064632
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
21064686 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
21064632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 22917563 - 22917617
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22917563 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
22917617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 29158351 - 29158413
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
29158351 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
29158413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 32725906 - 32725960
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
32725906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
32725960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 260 - 321
Target Start/End: Complemental strand, 1526180 - 1526119
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
1526180 |
tttttataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccc |
1526119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 8094843 - 8094786
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccg |
323 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8094843 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccccg |
8094786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 10873280 - 10873227
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccc |
10873227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 13779151 - 13779208
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgtaaa |
13779208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 265 - 326
Target Start/End: Original strand, 17073804 - 17073865
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
17073804 |
ataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
17073865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 265 - 326
Target Start/End: Complemental strand, 17574466 - 17574405
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
17574466 |
ataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
17574405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 27117751 - 27117812
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
27117751 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgtaaa |
27117812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 32418317 - 32418370
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32418317 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32418370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 34963664 - 34963611
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
34963611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 264 - 321
Target Start/End: Complemental strand, 35143848 - 35143791
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
35143848 |
aataggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccc |
35143791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 35346629 - 35346682
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
35346682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 37536419 - 37536366
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
37536366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 1525808 - 1525860
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1525808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 328
Target Start/End: Complemental strand, 7272751 - 7272691
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaac |
328 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgtaaac |
7272691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 318
Target Start/End: Original strand, 9496339 - 9496391
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
9496339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
9496391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 13232201 - 13232257
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
13232257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 14495068 - 14495128
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
14495068 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
14495128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 263 - 327
Target Start/End: Complemental strand, 18549578 - 18549514
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
18549578 |
taatagactaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
18549514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 20984511 - 20984451
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
20984511 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaa |
20984451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 28497616 - 28497560
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
28497560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 29488111 - 29488051
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
29488111 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaa |
29488051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 2811666 - 2811571
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||| || | |||||| || | |||||||||| ||| | | |||||||| |
|
|
| T |
2811666 |
tattttgcagggacctttttaaaaatcaaaatattttgcagggactatttatctataaaatgggtttagtcatcatgtgccacgtatacaaatcat |
2811571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 4375692 - 4375751
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaa |
4375751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 4473702 - 4473757
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
4473702 |
taggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccc |
4473757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 10540447 - 10540502
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| |||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
10540447 |
taggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccc |
10540502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 10776499 - 10776440
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
10776440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 11976738 - 11976683
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
11976738 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
11976683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 16643659 - 16643714
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16643659 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccc |
16643714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 24955012 - 24954957
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
24955012 |
taggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccc |
24954957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 33526414 - 33526359
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33526414 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccc |
33526359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 40066820 - 40066761
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgtaaa |
40066761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 40844156 - 40844215
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
40844215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 2728231 - 2728285
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
2728231 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccc |
2728285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 4017301 - 4017247
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4017301 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
4017247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 269 - 327
Target Start/End: Complemental strand, 6146948 - 6146890
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaa |
6146890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 318
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 14238750 - 14238804
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
14238750 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
14238804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 14847828 - 14847878
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14847828 |
taaaatatgattttgatccctgcaaatatgcctcattttggttttagtccc |
14847878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 16644045 - 16643991
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
16644045 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccc |
16643991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 265 - 319
Target Start/End: Original strand, 18549198 - 18549252
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
18549198 |
ataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
18549252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 264 - 318
Target Start/End: Original strand, 19494115 - 19494169
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
19494115 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19494169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 27117977 - 27117923
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
27117977 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccc |
27117923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 271 - 320
Target Start/End: Original strand, 1685117 - 1685166
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 273 - 326
Target Start/End: Original strand, 3680532 - 3680585
Alignment:
| Q |
273 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgtaa |
3680585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 6469278 - 6469339
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
6469278 |
taggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
6469339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 9175373 - 9175320
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||| ||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
9175373 |
taggttaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
9175320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 13779531 - 13779474
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgtaa |
13779474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 25131447 - 25131394
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccc |
25131394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 414 - 483
Target Start/End: Original strand, 27117837 - 27117906
Alignment:
| Q |
414 |
caaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||| |||| |||||| ||| ||| |||||||||||| |
|
|
| T |
27117837 |
caaaagattttgcagggactatttctctaataaatgggttcagtcatcacgtgccacgtgtgcaaatcat |
27117906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 28497254 - 28497307
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
28497254 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc |
28497307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 35345619 - 35345558
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
35345619 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgtaaa |
35345558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 42132864 - 42132917
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccc |
42132917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 269 - 321
Target Start/End: Original strand, 4016906 - 4016958
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccc |
4016958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 7272419 - 7272471
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
7272419 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
7272471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 8094476 - 8094532
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||||||||||||||||||| |
|
|
| T |
8094476 |
ataggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccc |
8094532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 9175011 - 9175071
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
9175011 |
aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgtaaa |
9175071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 13796593 - 13796537
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgtaaa |
13796537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 16789074 - 16789134
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
16789074 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaa |
16789134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 22650463 - 22650523
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
22650463 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaa |
22650523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 24815069 - 24815009
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgtaaa |
24815009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 25131110 - 25131170
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
25131110 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaa |
25131170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 25600598 - 25600538
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
25600598 |
aggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaa |
25600538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 266 - 326
Target Start/End: Original strand, 25702510 - 25702570
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||| |||||||||| |||| |
|
|
| T |
25702510 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgtaa |
25702570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 28324182 - 28324122
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || ||||||||||||||||| ||||| |
|
|
| T |
28324182 |
aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgtaaa |
28324122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 29158669 - 29158617
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc |
29158617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Complemental strand, 31445464 - 31445412
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
31445464 |
aggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 40066496 - 40066556
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||||| || ||||| |
|
|
| T |
40066496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgtaaa |
40066556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 266 - 326
Target Start/End: Original strand, 40492958 - 40493018
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
40492958 |
taggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgtaa |
40493018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 42430120 - 42430068
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
42430068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 44998263 - 44998211
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc |
44998211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 388 - 455
Target Start/End: Original strand, 5357548 - 5357615
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattca |
455 |
Q |
| |
|
||||||||| ||| ||| || ||||||||||||||||||||||||||||| || ||||||||| |||| |
|
|
| T |
5357548 |
tattttgcagggatcttattcaaaatcaaaagattttgcagggactatttctctaataaatgggttca |
5357615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 269 - 320
Target Start/End: Original strand, 6146517 - 6146568
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
6146568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 269 - 327
Target Start/End: Complemental strand, 14495389 - 14495331
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| || |||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccccataaa |
14495331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 15719656 - 15719715
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtcccggtaaa |
15719715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 273 - 320
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
273 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 320
Target Start/End: Complemental strand, 28258244 - 28258189
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||| ||||||||||||||||||| |
|
|
| T |
28258244 |
ataggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 28399039 - 28398976
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
28399039 |
aataggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgtaaa |
28398976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 33652330 - 33652425
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | || ||| |||||||||||||||||||| || |||||||||||| |||||||| || |||||||||| ||| |||||||||||| |
|
|
| T |
33652330 |
tattttggaggggcctatttaaaaatcaaaagattttacaaggactatttttctaataaatgagttatgtcatcatgtgccacgtgtgcaaatcat |
33652425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 1408354 - 1408300
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| ||||||||||| |
|
|
| T |
1408354 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccc |
1408300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 2355886 - 2355940
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
2355886 |
aggctaaaatataggtttgatccctgcaaatataccttgttttggttttagtccc |
2355940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 269 - 319
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc |
5357712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 14496815 - 14496869
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| ||||||||||||||||||| |
|
|
| T |
14496815 |
aggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccc |
14496869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 413 - 483
Target Start/End: Complemental strand, 16010793 - 16010723
Alignment:
| Q |
413 |
tcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||| |||||||||| |||||||||| | |||||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
16010793 |
tcaaaatattttgcaggaactatttttctacaaaatggattcaatcatcatgagtcacgtgtacaaatcat |
16010723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 21125718 - 21125772
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
21125718 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccc |
21125772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 24187898 - 24187844
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
24187898 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc |
24187844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 28323848 - 28323902
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28323848 |
aggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccc |
28323902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 263 - 321
Target Start/End: Complemental strand, 35115644 - 35115586
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
35115644 |
taataggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccc |
35115586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 38930665 - 38930611
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
38930665 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccc |
38930611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 42133068 - 42132994
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||||||| |||| |||||||||| || |||||||||||| |
|
|
| T |
42133068 |
aaaatcaaaagattttgtagggactatttctctaataaatgagttcagtcatcatgtgccaggtgtgcaaatcat |
42132994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 1162909 - 1162962
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccc |
1162962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 10755528 - 10755475
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| |||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccc |
10755475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 13155253 - 13155192
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
13155253 |
taggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgtaaa |
13155192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 271 - 320
Target Start/End: Complemental strand, 23939907 - 23939858
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| |||||||| |
|
|
| T |
23939907 |
taaaatatggttttgattcctgcaaatatgactcgttttggctttagtcc |
23939858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 263 - 320
Target Start/End: Original strand, 27341253 - 27341310
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||| |||||| ||||||||| |
|
|
| T |
27341253 |
taataggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagtcc |
27341310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 316
Target Start/End: Original strand, 44997930 - 44997979
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
44997930 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 14488715 - 14488767
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
14488715 |
aggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtc |
14488767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 14848186 - 14848131
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||| |||| |||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14848186 |
taaaatatgattttaatcc-tgcaaatatgtctcgttttggttttagtccccgtaaa |
14848131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 319
Target Start/End: Original strand, 29991918 - 29991966
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc |
29991966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 33526052 - 33526104
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 40844532 - 40844476
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgtaaa |
40844476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 263 - 318
Target Start/End: Original strand, 23939542 - 23939597
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||| |||||||| |||||||| |
|
|
| T |
23939542 |
taattggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 267 - 318
Target Start/End: Original strand, 38930301 - 38930352
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
38930301 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38930352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 42429757 - 42429815
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
42429757 |
aggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctgtaa |
42429815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 388 - 466
Target Start/End: Original strand, 6469442 - 6469519
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtg |
466 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| || || ||||| ||||||||| |||| |||| ||||| |
|
|
| T |
6469442 |
tattttgcagggaccttttcaaaaatcaaaagattttgca-agattaattttctaataaatgggttcagtcataatgtg |
6469519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 316
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 15930933 - 15930991
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| ||||| | ||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgtaaa |
15930991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 19962992 - 19963054
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| || ||| |||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
19962992 |
ataggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgtaaa |
19963054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 30969399 - 30969457
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| ||||||||||||||||||| ||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgtaaa |
30969457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 2356250 - 2356197
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||| ||||||||| ||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
2356250 |
taggttaaaatatgattttgattcatgcaaatatgtctcgttttggttttagtc |
2356197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 4376012 - 4375960
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
4376012 |
taggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #215
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 21126023 - 21125962
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||||| ||| || ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
21126023 |
taggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgtaaa |
21125962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #216
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 32040073 - 32040134
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| | || |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
32040073 |
taggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgtaaa |
32040134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #217
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 268 - 313
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt |
313 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #218
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 6469669 - 6469609
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
6469669 |
taggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgtaa |
6469609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #219
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 29487750 - 29487802
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #220
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 268 - 304
Target Start/End: Complemental strand, 30969717 - 30969681
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctc |
304 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #221
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 319
Target Start/End: Complemental strand, 1163274 - 1163223
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||| |||||| ||||||||| |
|
|
| T |
1163274 |
ggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtc |
1163223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #222
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 327
Target Start/End: Complemental strand, 1778917 - 1778870
Alignment:
| Q |
280 |
gttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctgtaaa |
1778870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #223
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 269 - 320
Target Start/End: Complemental strand, 7578527 - 7578476
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||| |||||| || |||||||||||| ||| ||||||||||||||| |
|
|
| T |
7578527 |
gctaaaatacggttttaattcctgcaaatatgactcattttggttttagtcc |
7578476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #224
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 14488937 - 14488894
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
14488937 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
14488894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #225
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 309
Target Start/End: Complemental strand, 25702811 - 25702768
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgtttt |
309 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
25702811 |
taggctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #226
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 30337144 - 30337101
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
30337144 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
30337101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #227
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 267 - 314
Target Start/End: Complemental strand, 30337218 - 30337171
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
314 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
30337218 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #228
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 271 - 318
Target Start/End: Original strand, 33652193 - 33652240
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagt |
33652240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #229
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 480
Target Start/End: Original strand, 37536216 - 37536286
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||| ||||| |||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
37536216 |
aaaaacaaaatattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
37536286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #230
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 268 - 310
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
310 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||||||||| |
|
|
| T |
9908918 |
ggctaaaatatagttttaatccctgcaaatatgtctcgttttg |
9908960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #231
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 287 - 321
Target Start/End: Complemental strand, 42430041 - 42430007
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42430041 |
tccctgcaaatatgcctcgttttggttttggtccc |
42430007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #232
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 270 - 320
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc |
43727382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #233
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 268 - 317
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
317 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #234
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 389 - 434
Target Start/End: Complemental strand, 19494341 - 19494296
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggacta |
434 |
Q |
| |
|
|||||||| |||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
19494341 |
attttgcagggaccttttttaaaaacaaaatattttgcagggacta |
19494296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #235
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 299
Target Start/End: Original strand, 22270941 - 22270974
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
22270941 |
taggctaaaatatgcttttgatccctgcaaatat |
22270974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #236
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 391 - 432
Target Start/End: Original strand, 29487891 - 29487932
Alignment:
| Q |
391 |
tttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
29487891 |
tttgcagggacctttttaaaaaacaaaatattttgcagggac |
29487932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #237
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 43727097 - 43727154
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| ||||||| || ||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgtaaa |
43727154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #238
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 8298660 - 8298700
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
8298660 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
8298700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #239
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 9832214 - 9832274
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||| |||||||||| ||| |||||||||| | |||||||||||| |||| ||||| |
|
|
| T |
9832214 |
aggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgtaaa |
9832274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #240
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 10540522 - 10540562
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
10540522 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
10540562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #241
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 14847898 - 14847938
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||| |
|
|
| T |
14847898 |
ttttgatccctgcaaatatgtctcgttttgattttggtccc |
14847938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #242
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 17074095 - 17074055
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
17074095 |
ttttggtccctacaaatatgcctcgttttgattttagtccc |
17074055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #243
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 271 - 319
Target Start/End: Original strand, 17574105 - 17574153
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| |||||||| |
|
|
| T |
17574105 |
taaaatatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17574153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #244
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 17574175 - 17574215
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
17574175 |
ttttggtccctacaaatatgcctcgttttgattttagtccc |
17574215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #245
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 267 - 299
Target Start/End: Complemental strand, 22534782 - 22534750
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
22534782 |
aggctaaaatatgcttttgatccctgcaaatat |
22534750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #246
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 23939620 - 23939660
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
23939620 |
ttttggtccctgcaaatatatctcgttttggttttagtccc |
23939660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #247
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 26530667 - 26530727
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||| |||||||||||| ||| |||||||||||||| |||| |||||||| || ||||| |
|
|
| T |
26530667 |
aggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctgtaaa |
26530727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #248
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 268 - 304
Target Start/End: Original strand, 28398756 - 28398792
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctc |
304 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28398756 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
28398792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #249
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 44998191 - 44998151
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
44998191 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
44998151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 2e-32; HSPs: 250)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 22540068 - 22540163
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
22540068 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgagttcaatcatcatgtgccaaatgtgcaaatcat |
22540163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 46829085 - 46829180
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||| |||||||||||| |
|
|
| T |
46829085 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaattggttcaatcatcatgtgtcatgtgtgcaaatcat |
46829180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 24717393 - 24717298
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
24717393 |
tattttgcagggacctttttaaaaatcaaaagattttgtagggactatttttctaataaatgggttcagtcatcatgtgtcatgtgtgcaaatcat |
24717298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 28262853 - 28262948
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||| |||| ||||||||| |||||||||||| |
|
|
| T |
28262853 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttatctaataaatgagttcagtcattatgtgtcacgtgtgcaaatcat |
28262948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 38486568 - 38486663
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
38486568 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgagttcagtcatcatgtgccacgtgtgcaaatcat |
38486663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 6589186 - 6589091
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
6589186 |
tattttgcagagacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
6589091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 11767142 - 11767047
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
11767142 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
11767047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 392 - 483
Target Start/End: Complemental strand, 34877994 - 34877903
Alignment:
| Q |
392 |
ttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||| | | |||||||||||| |
|
|
| T |
34877994 |
ttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaaaaaatgggttcaatcatcatgtgccgcgtgtgcaaatcat |
34877903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 35470055 - 35470150
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
35470055 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
35470150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 2945620 - 2945715
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||| ||| |||||||||| ||| |||||||||||| |
|
|
| T |
2945620 |
tattttgcagggacctttttaaaaatcaaaagattttgcaggaactatttttctaataaatgagttcggtcatcatgtgccacgtgtgcaaatcat |
2945715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 3807954 - 3808049
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | |||||||||||||||| ||||||||||||||||||||||| || ||||||||| ||| |||||||||||||| |||||||||||| |
|
|
| T |
3807954 |
tattttgtagggacctttttaaaaattaaaagattttgcagggactatttatctaataaatgggttcggtcatcatgtgtcacgtgtgcaaatcat |
3808049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 6846895 - 6846990
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
6846895 |
tattttgcagggacctttttcaaaatcaaaagattttacagagactatttttttaataaatggattcaatcatcatgtgccacgtgcgcaaatcat |
6846990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 35666100 - 35666005
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||| |||||||||||| |||||||| |||| |||||||||||||| | |||||||||| |
|
|
| T |
35666100 |
tattttgtagggacctttttaaaaatcaaaagattttgcaaggactatttttctaataaatgagttcagtcatcatgtgtcacgtatgcaaatcat |
35666005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 37527197 - 37527292
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
37527197 |
tattttgcagagatctttttaaaaatcaaaagattttgcagggactatttttctaataaatgagttcaggcatcatgtgtcacgtgtgcaaatcat |
37527292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 393 - 483
Target Start/End: Complemental strand, 30223681 - 30223591
Alignment:
| Q |
393 |
tgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
30223681 |
tgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
30223591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 393 - 483
Target Start/End: Original strand, 41053956 - 41054046
Alignment:
| Q |
393 |
tgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| |||||||| | ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
41053956 |
tgcagggacctttctcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacatgtgcaaatcat |
41054046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 31503558 - 31503650
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||| ||||| |
|
|
| T |
31503558 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtacaaat |
31503650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 393 - 493
Target Start/End: Complemental strand, 45228804 - 45228704
Alignment:
| Q |
393 |
tgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataaccaaaat |
492 |
Q |
| |
|
|||| |||||||| | ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| || ||||| |
|
|
| T |
45228804 |
tgcagggacctttatcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcatcacaaaaat |
45228705 |
T |
|
| Q |
493 |
g |
493 |
Q |
| |
|
| |
|
|
| T |
45228704 |
g |
45228704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 6892119 - 6892024
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||| ||||||| ||||||||| |||| ||||| | || ||| |||||||||||| |
|
|
| T |
6892119 |
tattttgcagggacctttttaaatatcaaaagattttgcagggacaatttttctaataaatgggttcagtcatcttctgccacctgtgcaaatcat |
6892024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 14543903 - 14543808
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | |||||||||| | ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
14543903 |
tattttgtagggacctttttcataatcaaaagattttgcaaagactatttctctaataaatggattcagtcatcatgtgtcacgtgtgcaaatcat |
14543808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 28529044 - 28529139
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||| || ||| ||||||||||||||||||||| |||| ||||||||||| |||||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
28529044 |
tattttacagggatctttttaaaaatcaaaagattgtgcattgactatttttctaataaatggattcagtcattatgtgtcacgtgtgcaaatcat |
28529139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 44841580 - 44841485
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||| || |||||||| ||||||||||||| ||||||||| |||| |||||||||| ||| ||| |||||||| |
|
|
| T |
44841580 |
tattttgcaaggacctttttaaaaatctaacgattttgcggggactatttttctaataaatgggttcagtcatcatgtgccacgtgtccaaatcat |
44841485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 388 - 470
Target Start/End: Original strand, 36684596 - 36684678
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcac |
470 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||| |||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
36684596 |
tattttgcagagaccttttcaaaaatcaaaagattttgcagggattatttttctaataaatgggttcagtcatcatgtgtcac |
36684678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 263 - 321
Target Start/End: Complemental strand, 48192493 - 48192435
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48192493 |
taataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
48192435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 388 - 449
Target Start/End: Original strand, 30760796 - 30760857
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatg |
449 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30760796 |
tatttggcatggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatg |
30760857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 1614905 - 1614845
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1614905 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
1614845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 3975548 - 3975608
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3975548 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
3975608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 8144434 - 8144525
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
8144434 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
8144525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 9659690 - 9659630
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9659690 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
9659630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 263 - 327
Target Start/End: Complemental strand, 17999726 - 17999662
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17999726 |
taataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
17999662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 23399836 - 23399745
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
23399836 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
23399745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 23676455 - 23676399
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23676455 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
23676399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 25092384 - 25092293
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
25092384 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
25092293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 26878074 - 26878018
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26878074 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
26878018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 29198527 - 29198436
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
29198527 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
29198436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 44568550 - 44568459
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
44568550 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttatctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
44568459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 45228919 - 45228859
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45228919 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
45228859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 5354893 - 5354988
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||| | ||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
5354893 |
tattttggagggacctttttcaaaatcaaaagattttgcaagaactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
5354988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 8144660 - 8144605
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8144660 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
8144605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 16853589 - 16853530
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
16853530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 23399610 - 23399665
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23399610 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
23399665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 389 - 480
Target Start/End: Original strand, 27037710 - 27037800
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||| | || | |||||||||| ||||||||||||| |
|
|
| T |
27037710 |
attttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatag-ttaagtcatcatgtgacacatgtgcaaat |
27037800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 29198664 - 29198609
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29198664 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
29198609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 404 - 483
Target Start/End: Original strand, 37159759 - 37159838
Alignment:
| Q |
404 |
ttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| ||||| |||||| || ||| |||||||||||| |
|
|
| T |
37159759 |
ttttaaaaatcaaaagattttgcaggaactatttttctaataaatgggttcaaccatcatatgacacgtgtgcaaatcat |
37159838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 38186537 - 38186632
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| || |||||||||||||||||| |||||||| ||||||||| || | |||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
38186537 |
tattttgcaggggcctttttaaaaatcaaaatattttgcatggactatttatctacaaaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
38186632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 3975840 - 3975786
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3975840 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 25988750 - 25988696
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988750 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
25988696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 44568691 - 44568637
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44568691 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccc |
44568637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 5354766 - 5354827
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
5354766 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaaa |
5354827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 35104297 - 35104236
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35104297 |
taggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
35104236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 35470282 - 35470221
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
35470282 |
taggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgtaaa |
35470221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 35838339 - 35838278
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
35838339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
35838278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 1614556 - 1614612
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
1614556 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
1614612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 12894403 - 12894343
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12894403 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
12894343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 492
Target Start/End: Complemental strand, 12932644 - 12932540
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataacc |
487 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||| | | ||| |||| |||||||||||||| ||| ||||||| || |
|
|
| T |
12932644 |
tattttgcatggaccttttcaaaaatcaaaagattttgcaaggactatttttctagtgtatgagttcagtcatcatgtgtcacgtgtttaaatcatcaca |
12932545 |
T |
|
| Q |
488 |
aaaat |
492 |
Q |
| |
|
||||| |
|
|
| T |
12932544 |
aaaat |
12932540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 263 - 327
Target Start/End: Complemental strand, 12932788 - 12932724
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
12932788 |
taataggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaa |
12932724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 19757747 - 19757807
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19757747 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
19757807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 25988525 - 25988616
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
25988525 |
tattttgtagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
25988616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 27458398 - 27458458
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
27458398 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
27458458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 28911907 - 28911847
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28911907 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
28911847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 41054238 - 41054178
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
41054238 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
41054178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 415 - 483
Target Start/End: Complemental strand, 48852642 - 48852574
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
48852642 |
aaaatattttgcagggactatttctctaataaatgggttcagtcatcatgtgtcacatgtgcaaatcat |
48852574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 263 - 318
Target Start/End: Original strand, 25547248 - 25547303
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25547248 |
taataggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 25988383 - 25988438
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
25988383 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
25988438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 327
Target Start/End: Original strand, 28262709 - 28262772
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
28262709 |
aataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaaa |
28262772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 327
Target Start/End: Original strand, 28911573 - 28911636
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
28911573 |
aataggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaa |
28911636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 404 - 483
Target Start/End: Complemental strand, 35104227 - 35104148
Alignment:
| Q |
404 |
ttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| || ||||||||| |||| ||||||||| ||| |||||||||||| |
|
|
| T |
35104227 |
ttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagccatcatgtgccacgtgtgcaaatcat |
35104148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 35665875 - 35665930
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35665875 |
taggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccc |
35665930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 271 - 326
Target Start/End: Original strand, 44841359 - 44841414
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgtaa |
44841414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 404 - 483
Target Start/End: Original strand, 46759764 - 46759843
Alignment:
| Q |
404 |
ttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| |||| ||||| |||||||||||||||||| || ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
46759764 |
ttttcaaaaacaaaatattttgcagggactatttctctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
46759843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 409 - 483
Target Start/End: Original strand, 3975635 - 3975709
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
3975635 |
aaaatcaaaagattttacagggactatttttctaataaatgagttcagtcatcatgtgccacgtgtgcaaatcat |
3975709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 5233807 - 5233861
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5233807 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
5233861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 388 - 466
Target Start/End: Complemental strand, 5234032 - 5233955
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtg |
466 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||||||||| || ||||||||| |||| |||||||||| |
|
|
| T |
5234032 |
tattttgcagggacctttttcaaaatcaaaatattttgcagggactatttctctaataaatgg-ttcagtcatcatgtg |
5233955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 6108333 - 6108387
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6108333 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
6108387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 8144294 - 8144348
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
8144294 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
8144348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 16940966 - 16940892
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
16940966 |
aaaatcaaaagattttgcagggactatttctctaataaatgagttcagtcatcatgtgccacgtgtgcaaatcat |
16940892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 23399977 - 23399923
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
23399977 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
23399923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 25092159 - 25092213
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
25092159 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
25092213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 25092549 - 25092495
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
25092549 |
aggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccc |
25092495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 26877677 - 26877731
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
26877677 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccc |
26877731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 44509055 - 44509001
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44509055 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
44509001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 46759656 - 46759710
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
46759656 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
46759710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 268 - 326
Target Start/End: Complemental strand, 46829312 - 46829254
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgtaa |
46829254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 48192260 - 48192310
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
48192310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 1006835 - 1006888
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
1006888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 9659351 - 9659408
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
9659351 |
aataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccc |
9659408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 11767277 - 11767216
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || |||||||||||||||| ||||| |
|
|
| T |
11767277 |
taggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgtaaa |
11767216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 20388272 - 20388333
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
20388272 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaa |
20388333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 27037593 - 27037646
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccc |
27037646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 30223796 - 30223743
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
30223796 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc |
30223743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 316
Target Start/End: Complemental strand, 34878126 - 34878077
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34878126 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 35837923 - 35837976
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
35837923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35837976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 38486792 - 38486739
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
38486792 |
taggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 39438739 - 39438792
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
39438739 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 39832904 - 39832965
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
39832904 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
39832965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 44508720 - 44508773
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
44508773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 48852443 - 48852496
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
48852443 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
48852496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 448
Target Start/End: Complemental strand, 1614764 - 1614704
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaat |
448 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
1614764 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaat |
1614704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 5234205 - 5234145
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
5234205 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaa |
5234145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 6509207 - 6509267
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
6509207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgtaaa |
6509267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 6509471 - 6509411
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6509471 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaa |
6509411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 6589021 - 6589073
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 8555800 - 8555740
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
8555800 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaa |
8555740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 16940761 - 16940821
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
16940761 |
aggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgtaaa |
16940821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 16941049 - 16940993
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaa |
16940993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 390 - 498
Target Start/End: Complemental strand, 20355638 - 20355530
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataaccaa |
489 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||| | ||||||||||| | | || ||| ||||||||||||||||||| ||| |||||||| || || |
|
|
| T |
20355638 |
ttttgcaaggacctttttaaaaagcaaaatattttacggggactattttctacaaaattgggttcaatcatcatgtgtcacgtgtacaaatcatcacaaa |
20355539 |
T |
|
| Q |
490 |
aatgagaca |
498 |
Q |
| |
|
| ||||||| |
|
|
| T |
20355538 |
agtgagaca |
20355530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 263 - 327
Target Start/End: Complemental strand, 21554758 - 21554694
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
21554758 |
taataggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaaa |
21554694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 318
Target Start/End: Original strand, 22539928 - 22539980
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
22539928 |
taggctaaaatatggttttgatccctccaaatatgcctcattttggttttagt |
22539980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 29198300 - 29198356
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
29198300 |
ataggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccc |
29198356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 35015223 - 35015167
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
35015223 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccc |
35015167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 37372905 - 37372845
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
37372905 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaaa |
37372845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 419 - 483
Target Start/End: Original strand, 39438835 - 39438899
Alignment:
| Q |
419 |
gattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||| || ||||||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
39438835 |
gattttgcagggactatttctctaataaatgggtttagtcatcatgtgtcacatgtgcaaatcat |
39438899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 41053841 - 41053901
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| |||||||||| ||||| |
|
|
| T |
41053841 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaaa |
41053901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 44344790 - 44344730
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
44344790 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
44344730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 45073642 - 45073582
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45073642 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
45073582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 48854071 - 48854011
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
48854071 |
aggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgtaaa |
48854011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 2945846 - 2945787
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
2945846 |
aggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
2945787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 319
Target Start/End: Complemental strand, 5355121 - 5355066
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||| |||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5355121 |
aataggttaaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 319
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 327
Target Start/End: Original strand, 10357997 - 10358060
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| | || ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10357997 |
aataggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
10358060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 10358368 - 10358309
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaa |
10358309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 17999465 - 17999524
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgtaaa |
17999524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 265 - 320
Target Start/End: Complemental strand, 18022707 - 18022652
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18022707 |
ataggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
18022652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 19561450 - 19561391
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
19561391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 23676130 - 23676185
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
23676130 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
23676185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 35210180 - 35210235
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
35210180 |
taggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccc |
35210235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 35210515 - 35210456
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
35210456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 319
Target Start/End: Original strand, 35469880 - 35469931
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
35469931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 35838149 - 35838054
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||| |||||||||| |||||||||| ||| |||| ||||||||| || ||||||||| | || |||||||||| ||| |||||||||||| |
|
|
| T |
35838149 |
tattttgccgggacctttttcaaaatcaaaaaattctgcaaggactatttctctaataaatgggtccagtcatcatgtgccacgtgtgcaaatcat |
35838054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 39833236 - 39833177
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaaa |
39833177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 46759942 - 46759883
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
46759883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 46828943 - 46829002
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
46828943 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
46829002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 277 - 327
Target Start/End: Complemental strand, 1271590 - 1271540
Alignment:
| Q |
277 |
atggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
1271540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 6079810 - 6079868
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaa |
6079868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 265 - 319
Target Start/End: Complemental strand, 6847122 - 6847068
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
6847122 |
atagactaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
6847068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 9659559 - 9659485
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||| |||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
9659559 |
aaaaacaaaatattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
9659485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 11766920 - 11766970
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccc |
11766970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 318
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 21223749 - 21223695
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21223749 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccc |
21223695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 30223460 - 30223514
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
30223460 |
aggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccc |
30223514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 39439030 - 39438976
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
39439030 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccc |
39438976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 328
Target Start/End: Complemental strand, 39719644 - 39719582
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaac |
328 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
39719644 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgtaaac |
39719582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 44568325 - 44568379
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
44568325 |
aggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccc |
44568379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 264 - 318
Target Start/End: Complemental strand, 45021860 - 45021806
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
45021860 |
aataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 271 - 320
Target Start/End: Complemental strand, 6589271 - 6589222
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
6589222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 263 - 320
Target Start/End: Original strand, 13769769 - 13769826
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
13769769 |
taattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
13769826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 14543709 - 14543762
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
14543709 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 23816668 - 23816721
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
23816668 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
23816721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 327
Target Start/End: Complemental strand, 32189388 - 32189331
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaa |
32189331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 45073312 - 45073373
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| |||| ||||| |
|
|
| T |
45073312 |
taggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgtaaa |
45073373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 1559706 - 1559646
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
1559706 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgtaaa |
1559646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 13770082 - 13770022
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
13770082 |
aggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgtaaa |
13770022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 415 - 483
Target Start/End: Original strand, 19005740 - 19005808
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||||||||||| ||| | ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19005740 |
aaaatattttgcagggacctatttactaataaatgggttcaatcatcatgtgtcacatgtgcaaatcat |
19005808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 264 - 320
Target Start/End: Original strand, 19783811 - 19783867
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
19783811 |
aataggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtcc |
19783867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 404 - 480
Target Start/End: Complemental strand, 26877886 - 26877811
Alignment:
| Q |
404 |
ttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
26877886 |
ttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
26877811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 38186369 - 38186425
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctgtaaa |
38186425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 39520397 - 39520457
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
39520397 |
aggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgtaaa |
39520457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 260 - 320
Target Start/End: Original strand, 43300604 - 43300664
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
43300604 |
ttttaatatgctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 44402959 - 44403019
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
44402959 |
aggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgtaaa |
44403019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 44958507 - 44958447
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
44958507 |
aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgtaaa |
44958447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 45228612 - 45228668
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
45228612 |
ataggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccc |
45228668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 1974009 - 1974068
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaa |
1974068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 20355406 - 20355461
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
20355406 |
taggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtccc |
20355461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 409 - 480
Target Start/End: Complemental strand, 23676335 - 23676265
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
23676335 |
aaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
23676265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 25547490 - 25547431
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaa |
25547431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 31732101 - 31732160
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgtaaa |
31732160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 272 - 327
Target Start/End: Original strand, 37372441 - 37372496
Alignment:
| Q |
272 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
37372496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 420 - 483
Target Start/End: Complemental strand, 39520591 - 39520528
Alignment:
| Q |
420 |
attttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
39520591 |
attttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
39520528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 14739005 - 14738951
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
14739005 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccc |
14738951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 265 - 327
Target Start/End: Complemental strand, 19465983 - 19465922
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| ||||||| |||||||||||| ||||| |
|
|
| T |
19465983 |
ataggctaaaatatggtttt-agccctgcaaatatgtctcgtttcggttttagtccctgtaaa |
19465922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 30352563 - 30352613
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccc |
30352613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 34877777 - 34877827
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccc |
34877827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 35104077 - 35104131
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
35104077 |
aggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccc |
35104131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 45021494 - 45021548
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgtttt-ggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccc |
45021548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 268 - 318
Target Start/End: Complemental strand, 48359075 - 48359025
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 3807862 - 3807923
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
3807862 |
taggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgtaaa |
3807923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 24717532 - 24717479
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||| |||||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccc |
24717479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 30352904 - 30352851
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccc |
30352851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 30709646 - 30709593
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
30709646 |
taggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 37527421 - 37527364
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| || ||||||||||||||||| |||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgtaa |
37527364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 41364884 - 41364937
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||| || |||||||| |||||||||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccc |
41364937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 44403249 - 44403196
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccc |
44403196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 46304085 - 46304138
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
46304085 |
aggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 316
Target Start/End: Complemental strand, 46648716 - 46648667
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
46648716 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 1007229 - 1007177
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtcc |
1007177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 5308687 - 5308628
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||| | ||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
5308687 |
aggctaaaatatgttttag-tccctgcaaatatacctcgttttggttttagtccctgtaaa |
5308628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 6892262 - 6892202
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| || ||||||| ||||||||| |||| |
|
|
| T |
6892262 |
taggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgtaa |
6892202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 316
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 7432249 - 7432201
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtc |
7432201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 17854151 - 17854207
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaa |
17854207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 21554393 - 21554445
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtcc |
21554445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 270 - 326
Target Start/End: Complemental strand, 28263069 - 28263013
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| |||||||||| |||| |
|
|
| T |
28263069 |
ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgtaa |
28263013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 39520727 - 39520671
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaaa |
39520671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 5308323 - 5308382
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaaa |
5308382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 272 - 319
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
| Q |
272 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
6954909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 319
Target Start/End: Original strand, 21223405 - 21223456
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
21223456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 267 - 314
Target Start/End: Complemental strand, 31310680 - 31310633
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
314 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
31310680 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 319
Target Start/End: Original strand, 39719353 - 39719404
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtc |
39719404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 46304384 - 46304325
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaa |
46304325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 1559342 - 1559396
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| ||||| |||| |
|
|
| T |
1559342 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccc |
1559396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 28528905 - 28528963
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| | |||| ||||||| ||||||| |||||||||||| |||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgtaa |
28528963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 317
Target Start/End: Complemental strand, 31732452 - 31732402
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
317 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
31732452 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 269 - 318
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 271 - 320
Target Start/End: Original strand, 30709328 - 30709377
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtcc |
30709377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 31310363 - 31310416
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
31310363 |
taggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtc |
31310416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 267 - 316
Target Start/End: Original strand, 36684534 - 36684583
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
36684534 |
aggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 267 - 319
Target Start/End: Complemental strand, 38186762 - 38186709
Alignment:
| Q |
267 |
aggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||| |||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
38186762 |
aggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 281 - 326
Target Start/End: Complemental strand, 41054163 - 41054118
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
41054118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 269 - 318
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||| | || ||||||||||||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 489073 - 489013
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
489073 |
aggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgtaaa |
489013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #211
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 287 - 327
Target Start/End: Original strand, 12894060 - 12894100
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
12894060 |
tccctgcaaatatgcctcgttttggttttaatccctgtaaa |
12894100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #212
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 260 - 320
Target Start/End: Complemental strand, 18311948 - 18311888
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||| ||| |||||||||| |||| |||||| ||||||||||||||||| ||||||||| |
|
|
| T |
18311948 |
ttttattagactaaaatatgattttaatccctctaaatatgcctcgttttgattttagtcc |
18311888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #213
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 287 - 327
Target Start/End: Complemental strand, 19758040 - 19758000
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
19758040 |
tccctgcaaatatgcctcattttggttttagtccctgtaaa |
19758000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #214
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 271 - 315
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #215
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
31503732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #216
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 268 - 316
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #217
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 266 - 318
Target Start/End: Original strand, 38486476 - 38486528
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||||| |||||||| |||||||| |
|
|
| T |
38486476 |
taggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt |
38486528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #218
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 2945512 - 2945555
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcct |
303 |
Q |
| |
|
||||||||| |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
2945512 |
ttttaatagcctaaaatatggtgttggtccctgcaaatatgcct |
2945555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #219
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #220
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 19465840 - 19465797
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
19465840 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
19465797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #221
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 20388675 - 20388616
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| || ||| ||||||||||||||||| ||||||| || ||||| |
|
|
| T |
20388675 |
ggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgtaaa |
20388616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #222
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 271 - 326
Target Start/End: Original strand, 31503423 - 31503478
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||| ||||| ||||||| ||| |||||||||||||||| |||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgtaa |
31503478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #223
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 403 - 466
Target Start/End: Original strand, 37952844 - 37952906
Alignment:
| Q |
403 |
tttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtg |
466 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
37952844 |
tttttaaaaaacaaaatattttacagggact-tttttctataaaatggattcaatcatcatgtg |
37952906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #224
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 265 - 328
Target Start/End: Original strand, 45671211 - 45671274
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaac |
328 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||| |||||||| |||||||| || |||||| |
|
|
| T |
45671211 |
ataggttaaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgtaaac |
45671274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #225
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 398 - 480
Target Start/End: Original strand, 1271384 - 1271466
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||| |||||||| |||| |||||||||| ||| ||| ||||| |
|
|
| T |
1271384 |
ggacctttttaaaaatcaaaaatatttgtcaggactatttttctgataaatgggttcagtcatcatgtgccacgtgtacaaat |
1271466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #226
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 281 - 319
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
3808068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #227
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 432
Target Start/End: Complemental strand, 6509330 - 6509288
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
6509330 |
ttttgcagggacctttttaaaaaacaaaatattttgcagggac |
6509288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #228
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 389 - 431
Target Start/End: Complemental strand, 10358225 - 10358183
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcaggga |
431 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
10358225 |
attttgcagggacctttttaaaaaacaaaatattttgcaggga |
10358183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #229
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 432
Target Start/End: Complemental strand, 13769992 - 13769950
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
13769992 |
ttttgcaaggacctttttaaaaagcaaaatattttgcagggac |
13769950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #230
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 268 - 318
Target Start/End: Original strand, 19005598 - 19005648
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||| |||||| |||||| ||||||| ||||||||| ||||||| |
|
|
| T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagt |
19005648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #231
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 270 - 320
Target Start/End: Original strand, 21488335 - 21488385
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||| | | || |||| |||||||||| |
|
|
| T |
21488335 |
ctaaaatatggttttgatccctgcaaatttacttcattttagttttagtcc |
21488385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #232
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 389 - 431
Target Start/End: Original strand, 21554531 - 21554573
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcaggga |
431 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
21554531 |
attttgcatggaccttttttaaaaacaaaatattttgcaggga |
21554573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #233
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 433 - 483
Target Start/End: Complemental strand, 27458579 - 27458529
Alignment:
| Q |
433 |
tatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||| || ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
27458579 |
tatttctctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
27458529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #234
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 289 - 327
Target Start/End: Complemental strand, 27458698 - 27458660
Alignment:
| Q |
289 |
cctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
27458698 |
cctgcaaatatgcctcgttttagttttagtccctgtaaa |
27458660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #235
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 271 - 309
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgtttt |
309 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgtttt |
44841673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #236
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 287 - 320
Target Start/End: Original strand, 14738619 - 14738652
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
14738619 |
tccctgcaaatatgcctcattttggttttagtcc |
14738652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #237
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 281 - 322
Target Start/End: Complemental strand, 19005865 - 19005824
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtcccc |
322 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
19005865 |
ttttggtccctgcaaatatgtctcgttttggttttggtcccc |
19005824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #238
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 37952671 - 37952728
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||| ||||||| || |||||||||||||||| ||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgtaaa |
37952728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #239
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 267 - 300
Target Start/End: Original strand, 41693644 - 41693677
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatg |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
41693644 |
aggctaaaatatgtttttgatccctgcaaatatg |
41693677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #240
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 43058752 - 43058809
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||| ||||| |||||||||||||| || |||||| |||||||||| ||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgtaaa |
43058809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #241
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 264 - 321
Target Start/End: Complemental strand, 45671552 - 45671495
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||| |||||||| ||||||||||| |
|
|
| T |
45671552 |
aataggttaaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccc |
45671495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #242
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 3975766 - 3975726
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
3975766 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
3975726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #243
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 9659428 - 9659468
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
9659428 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
9659468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #244
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #245
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 23817035 - 23816975
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| || ||| ||||||| ||||||||||| ||||| || ||||| |
|
|
| T |
23817035 |
aggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgtaaa |
23816975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #246
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 24953828 - 24953872
Alignment:
| Q |
276 |
tatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggttttagtcc |
24953872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #247
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 27458472 - 27458512
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
27458472 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
27458512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #248
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| |||||| ||||||| || ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #249
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 264 - 300
Target Start/End: Original strand, 40576762 - 40576798
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatg |
300 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
40576762 |
aataggctaaaatatgcttttggtccctgcaaatatg |
40576798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #250
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 41054103 - 41054063
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
41054103 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
41054063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 2e-32; HSPs: 242)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 13215200 - 13215295
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
13215200 |
tattttgcagggaccattttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacatgtgcaaatcat |
13215295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 391 - 483
Target Start/End: Complemental strand, 3832493 - 3832401
Alignment:
| Q |
391 |
tttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||| |||||||||||||| |||||||||||| |
|
|
| T |
3832493 |
tttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaataggttcagtcatcatgtgtcacgtgtgcaaatcat |
3832401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 43672157 - 43672065
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
43672157 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacgtgtgcaaat |
43672065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 1295322 - 1295417
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
1295322 |
tattttgcaaagacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgagttcagtcatcatgtgccacatgtgcaaatcat |
1295417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 35686116 - 35686211
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| || |||||||||||| |
|
|
| T |
35686116 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttttaataaatgggttcagtcatcatgtgctacgtgtgcaaatcat |
35686211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 36815609 - 36815704
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| |||| |||||||||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
36815609 |
tattttgcagggacctttttcaaaaccaaaagattttgcagggactatttctctaataaatggattcagtcatcatgtgtcacgtgtgcaaatcat |
36815704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 388 - 497
Target Start/End: Complemental strand, 7121176 - 7121067
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataacc |
487 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| | |||||||| ||||||||| || |||||||||||||||| |||||||||||| || |
|
|
| T |
7121176 |
tattttgcaatgacctttttaaaaatcaaaagattttgcaggaattatttttctaataaatgggtttaatcatcatgtgtcacgtgtgcaaatcatcaca |
7121077 |
T |
|
| Q |
488 |
aaaatgagac |
497 |
Q |
| |
|
||| |||||| |
|
|
| T |
7121076 |
aaagtgagac |
7121067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 403 - 480
Target Start/End: Complemental strand, 38231641 - 38231564
Alignment:
| Q |
403 |
tttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
38231641 |
tttttaaaaatcaaaagattttgcagggactatttttctaataaatggattcagtcatcatgtgccacatgtgcaaat |
38231564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 391 - 483
Target Start/End: Complemental strand, 16523211 - 16523119
Alignment:
| Q |
391 |
tttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
16523211 |
tttgcagggacctttttaaaaattaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
16523119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 3172391 - 3172296
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||| |||| |||||||| | |||||||||||||||| |
|
|
| T |
3172391 |
tattttgcagggacctttttaaaaatcaaaagattttgcaaggactatttttctaataaatgagttcagtcatcatgcgccacatgtgcaaatcat |
3172296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 11788277 - 11788182
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||| ||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
11788277 |
tattttgcaggaacctttttaaaaatcaaaagattttgcagggactatttttctaatagatgtgttcagttatcatgtgtcacatgtgcaaatcat |
11788182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 27109267 - 27109172
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
27109267 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
27109172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 34963937 - 34964031
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| |||||||||||||| ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
34963937 |
tattttgcagggacctttt-aaaaatcaaaagattttgtagggactatttttctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
34964031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 44559184 - 44559279
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |||||||||| || ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
44559184 |
tattttgcagggacctttttcaaaatcaaaagattttgcggggactatttctctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
44559279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 389 - 483
Target Start/End: Original strand, 37910896 - 37910990
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| ||||||| || |||||||||||||||| |
|
|
| T |
37910896 |
attttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatatgccacatgtgcaaatcat |
37910990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 13850746 - 13850650
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactattttt-caaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| || |||||||||||| ||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
13850746 |
tattttgcagtgaactttttaaaaattaaaagattttgcagggactattttttctaataaatgggttcaatcatcatgtgtcacgtgtgcaaatcat |
13850650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 404 - 483
Target Start/End: Original strand, 31909270 - 31909349
Alignment:
| Q |
404 |
ttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
31909270 |
ttttaaaaatcaaaacattttgcagggactatttttctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
31909349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 262 - 327
Target Start/End: Complemental strand, 16523331 - 16523266
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16523331 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
16523266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 146550 - 146459
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
146550 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
146459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 1138208 - 1138112
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactat-ttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||| |||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
1138208 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactattttttttaataaatgagttcagtcatcatgtgccacgtgtgcaaatcat |
1138112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 25705225 - 25705316
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
25705225 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
25705316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 20939100 - 20939195
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||| || ||| |||||||||||||||| |||||||||||||||||||||| ||||||||| |||| |||||||||| ||| |||| ||||||| |
|
|
| T |
20939100 |
tattttacaaggatctttttaaaaatcaaacgattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacgtgtgtaaatcat |
20939195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 35155517 - 35155422
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||| |||||||||| | ||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
35155517 |
tattttgcagggacctttttaaaaatcaaaatattttgcaggaactatttttctacaaaatgagttcagtcatcatgtggcacatgtgcaaatcat |
35155422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 24358946 - 24358892
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24358946 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
24358892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 4042609 - 4042662
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4042609 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 260 - 321
Target Start/End: Original strand, 41451829 - 41451890
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
41451829 |
ttttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
41451890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 2481558 - 2481498
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2481558 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
2481498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 4423894 - 4423954
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4423894 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
4423954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 8046328 - 8046388
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8046328 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaaa |
8046388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 15842685 - 15842594
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
15842685 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
15842594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 16673635 - 16673544
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
16673635 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
16673544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 20131541 - 20131450
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
20131541 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
20131450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 29859711 - 29859620
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
29859711 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
29859620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 29859873 - 29859813
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29859873 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
29859813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 30215730 - 30215639
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||| ||||| |
|
|
| T |
30215730 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtacaaat |
30215639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 32476094 - 32476154
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
32476094 |
aggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgtaaa |
32476154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 41452061 - 41451970
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
41452061 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
41451970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 404 - 483
Target Start/End: Complemental strand, 10671839 - 10671760
Alignment:
| Q |
404 |
ttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||| ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
10671839 |
ttttcaaaaacaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
10671760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 16522990 - 16523049
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16522990 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16523049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 24358614 - 24358669
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24358614 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
24358669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 25705451 - 25705396
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25705451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
25705396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 33575750 - 33575805
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33575750 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccc |
33575805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 269 - 320
Target Start/End: Complemental strand, 42696202 - 42696151
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 260 - 327
Target Start/End: Original strand, 44559054 - 44559121
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
44559054 |
tttttataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
44559121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 4424099 - 4424025
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
4424099 |
aaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
4424025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 14003743 - 14003689
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003743 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
14003689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 15842824 - 15842770
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15842824 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
15842770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 409 - 483
Target Start/End: Original strand, 23732125 - 23732199
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
23732125 |
aaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
23732199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 388 - 462
Target Start/End: Complemental strand, 29832014 - 29831940
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatca |
462 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||| ||||||||||| ||||||| | ||||||||||| |
|
|
| T |
29832014 |
tattttgcagggatctttttaaaaatcaaaagattttgcagagactatttttctaataaataggttcaatcatca |
29831940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 4794130 - 4794183
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccc |
4794183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 5334751 - 5334804
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
5334804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 5335040 - 5334987
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
5334987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 13215058 - 13215119
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
13215058 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
13215119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 20131681 - 20131628
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
20131628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 44985986 - 44985925
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
44985986 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaa |
44985925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 1138361 - 1138301
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||| |
|
|
| T |
1138361 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaa |
1138301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 4424186 - 4424126
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
4424186 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
4424126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 448
Target Start/End: Original strand, 5164088 - 5164148
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaat |
448 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
5164088 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggacaatttttctaataaat |
5164148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 18113088 - 18113148
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18113088 |
aggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgtaaa |
18113148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 24483892 - 24483832
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24483892 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
24483832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 25705084 - 25705144
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
25705084 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
25705144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 33732861 - 33732921
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33732861 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
33732921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 415 - 483
Target Start/End: Complemental strand, 34317996 - 34317928
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
34317996 |
aaaatattttgcagggactatttttctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
34317928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 264 - 320
Target Start/End: Original strand, 43788854 - 43788910
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43788854 |
aataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 270 - 321
Target Start/End: Original strand, 146328 - 146379
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
146379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 14003407 - 14003462
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14003407 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14003462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 15842459 - 15842514
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15842459 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
15842514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 16673773 - 16673718
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16673773 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccc |
16673718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 18113314 - 18113219
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| || ||||||| |||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| || |||| ||||||| |
|
|
| T |
18113314 |
tattttgcaggggcctttttttaaatcaaaagattttgcagggactatttctctaataaatgggttcactcatcatgtgctacgtgtgtaaatcat |
18113219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 20131315 - 20131370
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
20131315 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
20131370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 327
Target Start/End: Original strand, 26707869 - 26707932
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
26707869 |
aataggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgtaaa |
26707932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 265 - 328
Target Start/End: Complemental strand, 40302342 - 40302279
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaac |
328 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
40302342 |
ataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgtaaac |
40302279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 264 - 326
Target Start/End: Complemental strand, 11788420 - 11788358
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
11788420 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
11788358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 16900207 - 16900153
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16900207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
16900153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 16993598 - 16993544
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16993598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
16993544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 19184152 - 19184098
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19184152 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
19184098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 269 - 327
Target Start/End: Complemental strand, 20939324 - 20939266
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
20939266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 26814230 - 26814176
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26814230 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
26814176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 29859490 - 29859540
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
29859540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 30215421 - 30215475
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30215421 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
30215475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 33576118 - 33576064
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
33576118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
33576064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 34317798 - 34317856
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
34317856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 37271738 - 37271792
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37271738 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
37271792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 37272103 - 37272049
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37272103 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
37272049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 38980254 - 38980200
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38980254 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
38980200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 9195208 - 9195147
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9195208 |
taggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgtaaa |
9195147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 261 - 326
Target Start/End: Original strand, 10671623 - 10671688
Alignment:
| Q |
261 |
tttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
10671623 |
tttagtaggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgtaa |
10671688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 17541777 - 17541724
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17541777 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
17541724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 22881612 - 22881665
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22881612 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22881665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 27109073 - 27109126
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccc |
27109126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 37910754 - 37910815
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
37910754 |
taggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgtaaa |
37910815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 42695868 - 42695921
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
42695921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 43592044 - 43592105
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43592044 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaa |
43592105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 43597152 - 43597213
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43597152 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaaa |
43597213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 44985623 - 44985680
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
44985680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 1137983 - 1138039
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaa |
1138039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 2481417 - 2481326
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| || |||||||| ||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
2481417 |
tattttgcagggaccttttacaacatcaaaagcttttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
2481326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 264 - 320
Target Start/End: Complemental strand, 10671945 - 10671889
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
10671945 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
10671889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 11713846 - 11713786
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11713846 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
11713786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 23732039 - 23732091
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc |
23732091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 31644840 - 31644892
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
31644840 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
31644892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 37911121 - 37911061
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
37911121 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgtaaa |
37911061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 38731828 - 38731888
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38731828 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
38731888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 42358702 - 42358758
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
42358758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 146690 - 146631
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaa |
146631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 3838268 - 3838205
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
3838268 |
aataagctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
3838205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 4794355 - 4794260
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||| || |||| ||||| |||||||||||| |||||||||||| ||| || ||||||||| |||| |||||||||| ||| |||| ||||||| |
|
|
| T |
4794355 |
tattttacagggacatttttcaaaatcaaaagaatttgcagggactttttctctaataaatgggttcagtcatcatgtgccacgtgtgtaaatcat |
4794260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 8046648 - 8046589
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaa |
8046589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 11713485 - 11713544
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
11713544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 327
Target Start/End: Original strand, 13850518 - 13850581
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
13850518 |
aataggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgtaaa |
13850581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 17302144 - 17302085
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
17302144 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
17302085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 27311071 - 27311016
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27311071 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccc |
27311016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 31226077 - 31226018
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgtaaa |
31226018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 36622250 - 36622309
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
36622309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 272 - 327
Target Start/End: Complemental strand, 36806892 - 36806837
Alignment:
| Q |
272 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
36806837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 41694003 - 41693944
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
41693944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 10374775 - 10374833
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
10374833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 16673410 - 16673464
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||||| |
|
|
| T |
16673410 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccc |
16673464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 17541381 - 17541435
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
17541381 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccc |
17541435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 19183781 - 19183835
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
19183781 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
19183835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 29865222 - 29865280
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
29865280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 265 - 327
Target Start/End: Complemental strand, 29865514 - 29865452
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
29865514 |
ataggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaaa |
29865452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 265 - 327
Target Start/End: Complemental strand, 30215874 - 30215812
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
30215874 |
ataggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaaa |
30215812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 398 - 480
Target Start/End: Original strand, 33575932 - 33576013
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
33575932 |
ggacctttttcaaaatcaaaagattttgcaaggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
33576013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 264 - 318
Target Start/End: Complemental strand, 35686342 - 35686288
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
35686342 |
aataggataaaatatggttttgatccctgtaaatatgcttcgttttggttttagt |
35686288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 318
Target Start/End: Original strand, 40124966 - 40125016
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
40125016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 40125170 - 40125096
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||| | ||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
40125170 |
aaaatcaaaagattttgcaggaattatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
40125096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 44073808 - 44073754
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
44073808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccc |
44073754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 3172019 - 3172072
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
3172019 |
aggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 3172533 - 3172480
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
3172533 |
aggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 3671192 - 3671139
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
3671139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 5790558 - 5790611
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccc |
5790611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 5790899 - 5790846
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
5790846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 20658059 - 20658120
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
20658059 |
taggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaa |
20658120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 23989836 - 23989889
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23989836 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 26813866 - 26813919
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
26813919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 31909480 - 31909428
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
31909480 |
taggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc |
31909428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 33733241 - 33733188
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccc |
33733188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 38639410 - 38639463
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
38639410 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 40786458 - 40786519
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
40786458 |
taggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgtaaa |
40786519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 319
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 262 - 319
Target Start/End: Complemental strand, 44994067 - 44994010
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
44994067 |
ttaaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc |
44994010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 4042890 - 4042838
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 23732329 - 23732270
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
23732329 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctgtaaa |
23732270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 400 - 480
Target Start/End: Original strand, 24358733 - 24358812
Alignment:
| Q |
400 |
acctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| || ||||||| | || | |||||||||| ||| ||||||||| |
|
|
| T |
24358733 |
acctttttcaaaatcaaaagattttgcagggactatttctctaataaatag-ttaagtcatcatgtgacacgtgtgcaaat |
24358812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 27310875 - 27310934
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
27310875 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctgtaaa |
27310934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 270 - 318
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 34318083 - 34318031
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc |
34318031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 37228732 - 37228784
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
37228732 |
aggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc |
37228784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 40125290 - 40125230
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
40125290 |
aggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaaa |
40125230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 40301974 - 40302034
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
40301974 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaaa |
40302034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 41693673 - 41693733
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
41693673 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaa |
41693733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 415 - 483
Target Start/End: Complemental strand, 42696066 - 42695998
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||| || |||||||||| |||||||||||| |
|
|
| T |
42696066 |
aaaatattttgcagggactatttttctaataaatgggttcagtctacatgtgtcacgtgtgcaaatcat |
42695998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 271 - 326
Target Start/End: Complemental strand, 1295544 - 1295489
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgtaa |
1295489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 1497610 - 1497669
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaaa |
1497669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 270 - 321
Target Start/End: Complemental strand, 1497943 - 1497892
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccc |
1497892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 3671001 - 3671056
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
3671001 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccc |
3671056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 409 - 480
Target Start/End: Original strand, 5334837 - 5334907
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||| | || | |||||||||| ||||||||||||| |
|
|
| T |
5334837 |
aaaatcaaaagattttgcagggactatttctctaataaatag-ttaagtcatcatgtgacacatgtgcaaat |
5334907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 7814739 - 7814684
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
7814739 |
taggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccc |
7814684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 10375069 - 10375010
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgtaaa |
10375010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 12835325 - 12835384
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
12835384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 18113454 - 18113395
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgtaaa |
18113395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 25750741 - 25750836
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||| |||||||||||| ||||||||| | ||| ||||||| |||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
25750741 |
tattttgcagggacttttttaaaaatctaaagattttacgggggtcatttttctaataaatgagttcagtcatcatgtgccacgtgtgcaaatcat |
25750836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 26239162 - 26239107
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
26239162 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccc |
26239107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 314
Target Start/End: Original strand, 29831813 - 29831860
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29831813 |
aggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 409 - 480
Target Start/End: Complemental strand, 30215625 - 30215555
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||| ||||| |
|
|
| T |
30215625 |
aaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtacaaat |
30215555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 264 - 327
Target Start/End: Original strand, 32691309 - 32691372
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
32691309 |
aataggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgtaaa |
32691372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 263 - 326
Target Start/End: Complemental strand, 34964164 - 34964101
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |||||||| ||||||| ||| |||| |
|
|
| T |
34964164 |
taattggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgtaa |
34964101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 318
Target Start/End: Complemental strand, 36815836 - 36815785
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
36815836 |
aggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagt |
36815785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 2481192 - 2481246
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| | | |||||||||| |||||||||||||||||||| |
|
|
| T |
2481192 |
aggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccc |
2481246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 265 - 319
Target Start/End: Complemental strand, 3832640 - 3832586
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
3832640 |
ataggttaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 4843035 - 4842961
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||| |||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||| ||||||| |
|
|
| T |
4843035 |
aaaaacaaaatattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgaaaatcat |
4842961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 7814245 - 7814299
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
7814245 |
aggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccc |
7814299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 268 - 318
Target Start/End: Original strand, 9195054 - 9195104
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
9195104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 24483401 - 24483459
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgtaaa |
24483459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 36815485 - 36815547
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
36815485 |
ataggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgtaaa |
36815547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 38231431 - 38231489
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| |||||| |||||||||| |||| |
|
|
| T |
38231431 |
ggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgtaa |
38231489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 43789193 - 43789139
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| ||||||||||||||||||| |
|
|
| T |
43789193 |
aggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccc |
43789139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 10664982 - 10665043
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| | |||||||| ||||| |
|
|
| T |
10664982 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaaa |
10665043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 315
Target Start/End: Complemental strand, 13215367 - 13215318
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
13215367 |
taggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 315
Target Start/End: Complemental strand, 20658411 - 20658362
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
20658411 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 41791020 - 41791077
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaaa |
41791077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 2265398 - 2265338
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
2265398 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgtaaa |
2265338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 3837932 - 3837992
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
3837932 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgtaaa |
3837992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 269 - 321
Target Start/End: Original strand, 4842865 - 4842917
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccc |
4842917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 13850881 - 13850833
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| | ||||||||||||| ||||||||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtc |
13850833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 16968555 - 16968611
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgtaaa |
16968611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 23990193 - 23990137
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcaccgtaaa |
23990137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 25954423 - 25954367
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaaa |
25954367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 26238816 - 26238872
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaa |
26238872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 31225714 - 31225774
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
31225714 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgtaaa |
31225774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 31326253 - 31326193
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
31326253 |
aggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaaa |
31326193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 270 - 318
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 43597500 - 43597440
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||||| ||||| |
|
|
| T |
43597500 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaa |
43597440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 43672319 - 43672259
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
43672319 |
aggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaaa |
43672259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 43710709 - 43710649
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||| || ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43710709 |
aggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgtaaa |
43710649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 31325920 - 31325979
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgtaaa |
31325979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 319
Target Start/End: Complemental strand, 41791312 - 41791261
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||| |||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc |
41791261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 267 - 318
Target Start/End: Original strand, 43671933 - 43671984
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||||||||||||||| |
|
|
| T |
43671933 |
aggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagt |
43671984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 273 - 319
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
| Q |
273 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
4794422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 274 - 320
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
| Q |
274 |
aatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 35155620 - 35155566
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| || |||||| |||||||||| |
|
|
| T |
35155620 |
aggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccc |
35155566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 17912447 - 17912500
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
17912447 |
taggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
17912500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 25299747 - 25299804
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgtaaa |
25299804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 25954114 - 25954167
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
25954114 |
aggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc |
25954167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 271 - 320
Target Start/End: Complemental strand, 38231818 - 38231769
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
38231818 |
taaaatatgattttgatccctccaaatatgcttcgttttgattttagtcc |
38231769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 45442697 - 45442644
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
45442697 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 10665295 - 10665235
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||| |||||||||||||||| || ||||| |
|
|
| T |
10665295 |
aggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgtaaa |
10665235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 287 - 327
Target Start/End: Complemental strand, 22881949 - 22881909
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
22881949 |
tccctgcaaatatgtctcgttttggttttagtccctgtaaa |
22881909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 267 - 319
Target Start/End: Complemental strand, 39367761 - 39367709
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||| | |||||||||||||| |
|
|
| T |
39367761 |
aggctaaaatatggtcttgatccctgtaaatatgctttattttggttttagtc |
39367709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #212
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 271 - 318
Target Start/End: Original strand, 5006610 - 5006657
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
5006610 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5006657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #213
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 260 - 315
Target Start/End: Complemental strand, 5164493 - 5164438
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||| |||| ||||||||||||||||| |||||||||||| || ||||| ||||| |
|
|
| T |
5164493 |
ttttattaggttaaaatatggttttgattcctgcaaatatgtcttgttttagtttt |
5164438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #214
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 12413978 - 12414021
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
12413978 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
12414021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #215
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 12426038 - 12426081
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
12426038 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
12426081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #216
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 480
Target Start/End: Complemental strand, 14003612 - 14003542
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||| ||||| |||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
14003612 |
aaaaacaaaatattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
14003542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #217
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 288 - 327
Target Start/End: Complemental strand, 26708184 - 26708145
Alignment:
| Q |
288 |
ccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
26708184 |
ccctgcaaatacgcctcgttttggttttagtccctgtaaa |
26708145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #218
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 399 - 438
Target Start/End: Original strand, 29079835 - 29079874
Alignment:
| Q |
399 |
gacctttttaaaaatcaaaagattttgcagggactatttt |
438 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
29079835 |
gacctttttaaaaatcaaaatattttacagggactatttt |
29079874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #219
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 32691534 - 32691491
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
32691534 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
32691491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #220
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 271 - 318
Target Start/End: Complemental strand, 37229039 - 37228992
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
37228992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #221
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 43592267 - 43592224
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
43592267 |
attttgcagggacctttttaaaaaccaaaatattttgcagggac |
43592224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #222
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 1138055 - 1138097
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccccg |
323 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
1138055 |
ttttggtccctgcaaatatgtctcgttttggttttggtccccg |
1138097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #223
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 11788052 - 11788110
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||| | |||||| ||||||| ||| |||||||| ||||||||||| |||| |
|
|
| T |
11788052 |
ggctaaaatatgatgttgatctctgcaaaaatgtctcgttttcgttttagtccctgtaa |
11788110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #224
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 265 - 299
Target Start/End: Complemental strand, 12068407 - 12068373
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12068407 |
ataggctaaaatatgcttttgatccctgcaaatat |
12068373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #225
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 281 - 315
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29831885 |
ttttggtccctgcaaatatgcctcgttttggtttt |
29831919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #226
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 269 - 319
Target Start/End: Original strand, 34963796 - 34963846
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||| |||||| | |||||| |||||||| |
|
|
| T |
34963796 |
gctaaaatatggttttgatccctgctaatatgttttgttttgattttagtc |
34963846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #227
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 38979889 - 38979943
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatat-gcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccc |
38979943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #228
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 14393129 - 14393077
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| ||| | ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
14393129 |
aggctaaaatatgatttagttcc-tgcaaatatgtctcgttttggttttagtcc |
14393077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #229
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 287 - 316
Target Start/End: Complemental strand, 16900129 - 16900100
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16900129 |
tccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #230
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 287 - 316
Target Start/End: Complemental strand, 16993520 - 16993491
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16993520 |
tccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #231
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 26709694 - 26709747
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||| ||||||||||| |||||| |
|
|
| T |
26709694 |
taggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #232
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 425
Target Start/End: Complemental strand, 37228904 - 37228867
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttg |
425 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
37228904 |
tattttgcagggacctttttaaaaatcaaaaaattttg |
37228867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #233
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 267 - 316
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #234
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 4423968 - 4424008
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
4423968 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
4424008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #235
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 392 - 432
Target Start/End: Original strand, 4731827 - 4731867
Alignment:
| Q |
392 |
ttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
4731827 |
ttgcaaggacctttttaaaaaacaaaatattttgcagggac |
4731867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #236
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 4794203 - 4794243
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
4794203 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
4794243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #237
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 16523062 - 16523102
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||| ||||| |
|
|
| T |
16523062 |
ttttggtccctgcaaatatgcctcgtttaggttttggtccc |
16523102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #238
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 403 - 455
Target Start/End: Complemental strand, 25299947 - 25299896
Alignment:
| Q |
403 |
tttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattca |
455 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| || || |||||||||||||| |
|
|
| T |
25299947 |
tttttcaaaatcaaaagattttgca-ggactacttctctaataaatggattca |
25299896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #239
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 270 - 318
Target Start/End: Complemental strand, 25300038 - 25299991
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagt |
25299991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #240
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 29182167 - 29182219
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||| || |||||||||||||| |
|
|
| T |
29182167 |
aggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtc |
29182219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #241
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 41451910 - 41451950
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
41451910 |
ttttgatccctgcaaatatgtctcattttggttttggtccc |
41451950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #242
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 388 - 432
Target Start/End: Complemental strand, 43710602 - 43710558
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||||| |||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
43710602 |
tattttgcagggaccttttttaaaaacaaaatattttgcagggac |
43710558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 2e-32; HSPs: 278)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 12322830 - 12322735
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||| |||||||| |||||||||||||||| |
|
|
| T |
12322830 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaattggttcaattatcatgtgccacatgtgcaaatcat |
12322735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 28507340 - 28507245
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
28507340 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctcataaatgagttcagtcatcatgtgtcacatgtgcaaatcat |
28507245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 24978004 - 24977909
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
24978004 |
tattttgcaaggacctttttcaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
24977909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 12360828 - 12360733
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||| |||| ||||| |||||||||||||||| |
|
|
| T |
12360828 |
tattttgcagggacctttttacaaatcaaaagattttgcagggactatttttttaataaatgggttcactcattatgtgccacatgtgcaaatcat |
12360733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 15058643 - 15058548
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| || |||| |||| |||||| || |||||||||||| |
|
|
| T |
15058643 |
tattttgcaaggacctttttaaaaatcaaaagattttgcagggactatttttctaataaacgggttcagtcattatgtgttacgtgtgcaaatcat |
15058548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 33045581 - 33045486
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
33045581 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcactcatcatgtgccacgtgtgcaaatcat |
33045486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 33234772 - 33234677
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| |||| |||| |||||| ||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
33234772 |
tattatgcagggacgtttttacaaatcaaaagattttgcagggactatttttctaataaatgggttcactcatcatgtgccacatgtgcaaatcat |
33234677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 46183914 - 46183819
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
46183914 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
46183819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 17129859 - 17129954
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||| || ||| |||||||||||| |
|
|
| T |
17129859 |
tattttgcaaggaccattttaaaaatcaaaagattttgcagggactatttttttaataaatgggttcagtcatcatctgccacgtgtgcaaatcat |
17129954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 24510167 - 24510072
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||| |||||||||||| ||||||| | |||| |||||||||| ||||| |||||||||| |
|
|
| T |
24510167 |
tattttgcagggatctttttaaaaatcaaaagattttgcatggactatttttctaataaataggttcagtcatcatgtgccacatctgcaaatcat |
24510072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 39747698 - 39747603
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| |||||||||||| |
|
|
| T |
39747698 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggtttagtcatcatgtgccacgtgtgcaaatcat |
39747603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 400 - 483
Target Start/End: Original strand, 51986363 - 51986446
Alignment:
| Q |
400 |
acctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||| |||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
51986363 |
acctttttaaaaatcaaaagattttgcaaggattatttttttaataaatggattcagtcatcatgtgtcacgtgtgcaaatcat |
51986446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 49073831 - 49073923
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
49073831 |
tattttgcagggacctttttaaaaatcaaaagattttgcatggactatttttctaataaatggattca---gtcatgtgacacgtgtgcaaatcat |
49073923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 3247338 - 3247429
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
3247338 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
3247429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 486
Target Start/End: Original strand, 15211634 - 15211729
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataac |
486 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| || | |||||||||| ||||||||||||||||| |
|
|
| T |
15211634 |
tattttgcagggacctttttaaaaatcaaaagattttgtagggactatttttctaataaatgagtttagtcatcatgtg---catgtgcaaatcataac |
15211729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 7350512 - 7350606
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||| || | |||||||||| ||| | |||||||||| |
|
|
| T |
7350512 |
tattttgcaaggacctttttaaaaatcaaaagattttgcagggattatttttctaataaatgggtttagtcatcatgtgccacgt-tgcaaatcat |
7350606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 10887458 - 10887363
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
10887458 |
tattttgcagagacctttttcaaaattaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
10887363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 15466357 - 15466262
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||| |||||||||| ||||||||||||||||||||| ||||||||| |||| ||||||||| ||| |||||||||||| |
|
|
| T |
15466357 |
tattttgcagggatctttttgaaaatcaaaaaattttgcagggactatttttctaataaatgggttcagacatcatgtgccacgtgtgcaaatcat |
15466262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 392 - 483
Target Start/End: Complemental strand, 31404638 - 31404547
Alignment:
| Q |
392 |
ttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||| |||||||||| | | ||||| |||||| |
|
|
| T |
31404638 |
ttgcagggacctttttaaaaatcaaaagattttgcagggactacttttctaataaatgggttcactcatcatgtgccgcgtgtgctaatcat |
31404547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 41739021 - 41738926
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||| | |||| |||||||||| ||| |||||||||||| |
|
|
| T |
41739021 |
tattttgcagagaccttttccaaaatcaaaagattttgcagggactatttttctaataaataggttcagtcatcatgtgccacgtgtgcaaatcat |
41738926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 42483107 - 42483201
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||| ||||| ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
42483107 |
tattttgcagggacctttttaaaaatcaaaagattttgtcgggactacttttctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaatcat |
42483201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 24507479 - 24507532
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
24507532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 47819228 - 47819285
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47819228 |
aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
47819285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 8140574 - 8140665
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
8140574 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
8140665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 10631304 - 10631395
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
10631304 |
tattttgcagagacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
10631395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 15516806 - 15516715
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
15516806 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
15516715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 16026714 - 16026805
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
16026714 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
16026805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 24507844 - 24507784
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24507844 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
24507784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 24653942 - 24654033
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
24653942 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
24654033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 31060927 - 31061018
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
31060927 |
tattttgcaaggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
31061018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 33000445 - 33000536
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
33000445 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
33000536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 33045691 - 33045631
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33045691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
33045631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 38151072 - 38150981
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
38151072 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
38150981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 38164155 - 38164064
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
38164155 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
38164064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 263 - 327
Target Start/End: Complemental strand, 39747840 - 39747776
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
39747840 |
taataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
39747776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 40718250 - 40718341
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
40718250 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
40718341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 45380496 - 45380405
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
45380496 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
45380405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 45638804 - 45638713
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||| ||||| |
|
|
| T |
45638804 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtacaaat |
45638713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 47819456 - 47819365
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||| | || | |||||||||| ||||||||||||| |
|
|
| T |
47819456 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatag-ttaagtcatcatgtgacacatgtgcaaat |
47819365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 4789533 - 4789438
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||| ||||||| ||||||||| |||| |||||||||| ||| ||| ||||||| |
|
|
| T |
4789533 |
tattttgcagagaccttttcaaaaatcaaaagattttgcagggaccatttttctaataaatgggttcagtcatcatgtgccacgtgtttaaatcat |
4789438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 8364751 - 8364846
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | || |||||||||||||||||||||||| ||||||||||||| |||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
8364751 |
tattttgtagggccctttttaaaaatcaaaagattttatagggactatttttttaataaatgagttcagtcatcatgtgtcacgtgtgcaaatcat |
8364846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 19198724 - 19198819
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| |||||||||| ||||||||| ||| | |||||||| ||| |||||||||||| |
|
|
| T |
19198724 |
tattttgcagggacctttttaaaattcaaaagattttgcagagactatttttttaataaatgggttccgttatcatgtgccacgtgtgcaaatcat |
19198819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 26324722 - 26324817
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||| | ||| |||| ||||| || |||||||||||| |
|
|
| T |
26324722 |
tattttgcagggacctttttaaaaatcaaaagattttgcaggggctatttttctaataaataggctcagtcattatgtgacatgtgtgcaaatcat |
26324817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 26699514 - 26699420
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||| ||||||||||||| || | |||| ||||||||||||||||||| || | ||||||| |
|
|
| T |
26699514 |
tattttgcaaggacctttttaaaaatcaaaatattttgcggggactatttttctaa-atatgggttcaatcatcatgtgtcacgtgcgtaaatcat |
26699420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 38151212 - 38151153
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
38151153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 262 - 321
Target Start/End: Complemental strand, 38164301 - 38164242
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38164301 |
ttaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
38164242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 44157817 - 44157912
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| |||| ||||| |||||||||||||||||| | ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
44157817 |
tattttgcagggacctttttcaaaaacaaaatattttgcagggactatttctttaataaatgggttcactcatcatgtgccacgtgtgcaaatcat |
44157912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 48730393 - 48730488
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||| |||||||||| |||| ||||||| ||||||||||||| | |||| | |||| |||||||||||||| |||||||||||| |
|
|
| T |
48730393 |
tattttgcatggaccattttaaaaattaaaatattttgctgggactatttttctacaaaataggttcagtcatcatgtgtcacgtgtgcaaatcat |
48730488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 13770486 - 13770548
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13770486 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
13770548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 16060799 - 16060725
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
16060799 |
aaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
16060725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 263 - 321
Target Start/End: Original strand, 18473267 - 18473325
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18473267 |
taataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
18473325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 19623018 - 19622964
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19623018 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccc |
19622964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 22919681 - 22919743
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22919681 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
22919743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 26324582 - 26324644
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26324582 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
26324644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 29688429 - 29688375
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29688429 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccc |
29688375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 44157696 - 44157754
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
44157754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 47819597 - 47819543
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47819597 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
47819543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 8140432 - 8140493
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
8140432 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
8140493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 264 - 321
Target Start/End: Complemental strand, 16026942 - 16026885
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
16026942 |
aataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccc |
16026885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 17129691 - 17129748
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgtaaa |
17129748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 24653802 - 24653855
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
24653855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 46183686 - 46183743
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccccgtaaa |
46183743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 52254182 - 52254235
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52254182 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
52254235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 3247197 - 3247257
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
3247197 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
3247257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 12360969 - 12360909
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
12360969 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
12360909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 18302388 - 18302328
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
18302328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 19720711 - 19720771
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
19720711 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
19720771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 24507703 - 24507612
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||| | || | |||||||||| ||| ||||||||| |
|
|
| T |
24507703 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatag-ttaagtcatcatgtgacacgtgtgcaaat |
24507612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 29072496 - 29072556
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29072496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
29072556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 30323069 - 30323160
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
30323069 |
tattttgtagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
30323160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 32035567 - 32035665
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttt---tcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| || || |||| || ||||||||| |||| |||||||||||||| ||| |||||||| |
|
|
| T |
32035567 |
tattttgcagggacctttttaaaaatcaaaagattttgcatgggcttttttttctctaataaatgggttcagtcatcatgtgtcacgtgtacaaatcat |
32035665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 35056670 - 35056761
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
35056670 |
tattttgtagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
35056761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 35056897 - 35056841
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35056897 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccc |
35056841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 45368489 - 45368549
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45368489 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
45368549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 990381 - 990326
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
990381 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
990326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 3247564 - 3247509
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3247564 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
3247509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 327
Target Start/End: Original strand, 3753209 - 3753272
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3753209 |
aataagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
3753272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 10631164 - 10631223
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
10631223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 10887600 - 10887545
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
10887600 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
10887545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 15516580 - 15516635
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15516580 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccc |
15516635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 16060885 - 16060826
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaa |
16060826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 18928002 - 18927907
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | ||||||||| ||||||||||||||||| ||| ||||||||||| ||||||| | |||| |||||||||| ||| |||| ||||||| |
|
|
| T |
18928002 |
tattttgtagggaccttttcaaaaatcaaaagattttacagtgactatttttctaataaattggttcagtcatcatgtgccacgtgtgtaaatcat |
18927907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 30323295 - 30323240
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30323295 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccc |
30323240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 33000305 - 33000364
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaa |
33000364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 33234545 - 33234604
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
33234545 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
33234604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 35308111 - 35308052
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
35308052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 37624911 - 37624816
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||| |||| |||||||||||||||||| || | ||||||||||| |||| ||||| ||| |||||||||||| |
|
|
| T |
37624911 |
tattttgcagagacctttttaaaaattaaaatattttgcagggactatttctctacaaaatggattcattcatgatgtgccacgtgtgcaaatcat |
37624816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 45380270 - 45380325
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
45380270 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
45380325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 1810926 - 1810980
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1810926 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
1810980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 273 - 327
Target Start/End: Original strand, 2939934 - 2939988
Alignment:
| Q |
273 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaaa |
2939988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 8140800 - 8140746
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
8140800 |
aggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccc |
8140746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 10631529 - 10631475
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
10631529 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccc |
10631475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 15526363 - 15526309
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
15526363 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
15526309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 18473596 - 18473542
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18473596 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
18473542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 409 - 483
Target Start/End: Original strand, 25658099 - 25658172
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
25658099 |
aaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccac-tgtgcaaatcat |
25658172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 26061955 - 26062009
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26061955 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
26062009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 30322928 - 30322982
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
30322928 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
30322982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 31061152 - 31061098
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31061152 |
aggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccc |
31061098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 261 - 327
Target Start/End: Complemental strand, 32454301 - 32454235
Alignment:
| Q |
261 |
tttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
32454301 |
tttattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaaa |
32454235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 32729050 - 32728996
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32729050 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
32728996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 33000670 - 33000616
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
33000670 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
33000616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 33379887 - 33379941
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33379887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
33379941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 388 - 481
Target Start/End: Complemental strand, 34002801 - 34002707
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactat-ttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatc |
481 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||| |||| ||||||| | ||| |||||||||| ||| |||||||||| |
|
|
| T |
34002801 |
tattttgcagggacctttttaaaaatcaaaagattttgcaaggactattttttttaataaattggctcagtcatcatgtgccacgtgtgcaaatc |
34002707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 35005746 - 35005692
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35005746 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 38163934 - 38163984
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
38163984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 41358368 - 41358422
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
41358422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 7001897 - 7001844
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
7001844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 7819105 - 7819052
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
7819105 |
taggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtc |
7819052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 11822003 - 11822056
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11822003 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
11822056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 406 - 483
Target Start/End: Complemental strand, 18079606 - 18079529
Alignment:
| Q |
406 |
ttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | |||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
18079606 |
ttaaaaatcaaaatattttgcagggactatttttctacaaaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
18079529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 24977778 - 24977831
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
24977831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 33045353 - 33045414
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
33045353 |
taggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgtaaa |
33045414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 35056530 - 35056583
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
35056583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 38136981 - 38136928
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccc |
38136928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 40718110 - 40718163
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
40718163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 45380636 - 45380583
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccc |
45380583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 45638580 - 45638633
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
45638633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 46868577 - 46868524
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccc |
46868524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 50429211 - 50429150
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50429211 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
50429150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 50799128 - 50799189
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
50799128 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
50799189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 3679625 - 3679685
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3679625 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaa |
3679685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 4789310 - 4789366
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4789366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 6567497 - 6567437
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
6567497 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
6567437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 262 - 326
Target Start/End: Original strand, 12360597 - 12360661
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||| ||||||| ||| |||| |
|
|
| T |
12360597 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctgtaa |
12360661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 12361010 - 12361070
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
12361010 |
aggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaaa |
12361070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 14007488 - 14007548
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
14007548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 19720850 - 19720941
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| ||||||||| || |||||| || |||| |||||||||| ||| ||||||||| |
|
|
| T |
19720850 |
tattttgcagggaccttttacaaaatcaaaagattttgcaaggactatttctctaataaa-ggcttcagtcatcatgtgccacgtgtgcaaat |
19720941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 26442900 - 26442840
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26442900 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaaa |
26442840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 460
Target Start/End: Complemental strand, 32420317 - 32420245
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcat |
460 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||| |||| |||||||||| ||||||||| |||| |||| |
|
|
| T |
32420317 |
tattttgcagggacctttttaaaaatccaaagattttacaggaactatttttctaataaatgggttcagtcat |
32420245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 35307714 - 35307774
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
35307714 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
35307774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 269 - 321
Target Start/End: Original strand, 44641079 - 44641131
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
44641131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 260 - 327
Target Start/End: Complemental strand, 4565344 - 4565277
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
4565344 |
ttttaataggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgtaaa |
4565277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 10887231 - 10887286
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
10887231 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccc |
10887286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 12322970 - 12322911
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgtaaa |
12322911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 13260323 - 13260268
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
13260323 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
13260268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 269 - 320
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
15058470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 318
Target Start/End: Complemental strand, 15058767 - 15058716
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15058767 |
aggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 18208908 - 18208813
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | |||| |||||||||||||||| ||||||||||||||||||||| || | |||| |||| ||||| | || ||| |||||||||||| |
|
|
| T |
18208908 |
tattttgaagggacttttttaaaaatcaaaatattttgcagggactatttttctaaaatatgggttcagtcatcctctgccacgtgtgcaaatcat |
18208813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 19622653 - 19622708
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
19622653 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
19622708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 21391094 - 21391149
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
21391094 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
21391149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 29072862 - 29072803
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgtaaa |
29072803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 33234912 - 33234853
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgtaaa |
33234853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 41738796 - 41738855
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgtaaa |
41738855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 319
Target Start/End: Original strand, 42482975 - 42483030
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
42482975 |
aataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42483030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 44641432 - 44641373
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
44641373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 45290822 - 45290767
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
45290822 |
taggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccc |
45290767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 48956066 - 48956007
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaa |
48956007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 52254479 - 52254420
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaa |
52254420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 990087 - 990141
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
990087 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccc |
990141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 3753573 - 3753519
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
3753573 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
3753519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 19721071 - 19721021
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccc |
19721021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 317
Target Start/End: Complemental strand, 24654168 - 24654118
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
317 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
24654168 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
24654118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 31258338 - 31258392
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
31258338 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
31258392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 35005443 - 35005497
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
35005443 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccc |
35005497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 38150851 - 38150901
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
38150901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 264 - 318
Target Start/End: Complemental strand, 41358667 - 41358613
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
41358667 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
41358613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 44158043 - 44157989
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44158043 |
aggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccc |
44157989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 45290456 - 45290510
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
45290456 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
45290510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 316
Target Start/End: Complemental strand, 45638896 - 45638846
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
45638896 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 11822367 - 11822306
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
11822367 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgtaaa |
11822306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 13259986 - 13260047
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
13259986 |
taggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgtaaa |
13260047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 19198948 - 19198891
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||| |||||||||| |||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgtaa |
19198891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 317
Target Start/End: Original strand, 24649350 - 24649399
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
24649399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 24649662 - 24649601
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24649662 |
taggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaa |
24649601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 327
Target Start/End: Complemental strand, 25658299 - 25658242
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
25658299 |
ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgtaaa |
25658242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 263 - 320
Target Start/End: Original strand, 26191354 - 26191411
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
26191354 |
taattggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
26191411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 26207280 - 26207337
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaaa |
26207337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 31060787 - 31060840
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccc |
31060840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 37545628 - 37545681
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccc |
37545681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 39025381 - 39025329
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccc |
39025329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 48609596 - 48609543
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
48609596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
48609543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 48955712 - 48955765
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48955712 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 5058989 - 5058933
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||| |||||||||| ||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgtaaa |
5058933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 319
Target Start/End: Original strand, 8364619 - 8364667
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
8364667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 12322604 - 12322656
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtcc |
12322656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 15211510 - 15211562
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
15211510 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
15211562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 16060595 - 16060646
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
16060595 |
aggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtc |
16060646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 17984332 - 17984384
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17984332 |
aggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc |
17984384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 388 - 448
Target Start/End: Original strand, 20948876 - 20948936
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaat |
448 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |||||||| || ||||||| |
|
|
| T |
20948876 |
tattttgcagggacctttttcaaaatcaaaagattttgcagagactatttctctaataaat |
20948936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 26191734 - 26191682
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26191682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 26442563 - 26442615
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 269 - 321
Target Start/End: Original strand, 32420099 - 32420151
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccc |
32420151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 32626528 - 32626588
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
32626528 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaa |
32626588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 34002941 - 34002881
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
34002941 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgtaaa |
34002881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 415 - 483
Target Start/End: Complemental strand, 39025247 - 39025179
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
39025247 |
aaaatattttgcagggactatttttctaataaatgggttcggtcatcatgtgtcacgagtgcaaatcat |
39025179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 48609235 - 48609295
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
48609235 |
aggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgtaaa |
48609295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 7867358 - 7867299
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
7867358 |
aggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgtaa |
7867299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 319
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 18079397 - 18079456
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
18079397 |
aggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgtaa |
18079456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 271 - 326
Target Start/End: Complemental strand, 18900130 - 18900075
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaa |
18900075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 25658014 - 25658073
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgtaaa |
25658073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 264 - 319
Target Start/End: Complemental strand, 26324951 - 26324896
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
26324951 |
aataggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc |
26324896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 260 - 327
Target Start/End: Original strand, 34808189 - 34808256
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| ||||| |||||||||||||| ||||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
34808189 |
tttttataggttaaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgtaaa |
34808256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 263 - 310
Target Start/End: Original strand, 36912848 - 36912895
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
310 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
36912848 |
taataggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 409 - 480
Target Start/End: Original strand, 38136778 - 38136848
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
38136778 |
aaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
38136848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 269 - 319
Target Start/End: Original strand, 4323829 - 4323879
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
4323879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 268 - 314
Target Start/End: Complemental strand, 15211858 - 15211812
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
314 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
15211812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 388 - 434
Target Start/End: Complemental strand, 15526220 - 15526174
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggacta |
434 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15526220 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggacta |
15526174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 16026572 - 16026626
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16026572 |
aggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccc |
16026626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 270 - 316
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 21383101 - 21383163
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||| |||||||||||||||||||| ||||| |
|
|
| T |
21383101 |
ataggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaa |
21383163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 265 - 319
Target Start/End: Original strand, 22674200 - 22674254
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||| | ||| |||||||||| |||||||||||||||||| |
|
|
| T |
22674200 |
ataggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 22919979 - 22919925
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
22919979 |
taggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc |
22919925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 27521577 - 27521635
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaa |
27521635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 264 - 326
Target Start/End: Complemental strand, 28507462 - 28507400
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||| ||| |||| ||||||||||| |||| |
|
|
| T |
28507462 |
aataggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgtaa |
28507400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 31258699 - 31258649
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccc |
31258649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 274 - 320
Target Start/End: Original strand, 32035442 - 32035488
Alignment:
| Q |
274 |
aatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
32035442 |
aatatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
32035488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 39303675 - 39303733
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| ||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgtaaa |
39303733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 41881092 - 41881146
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
41881092 |
aggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccc |
41881146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 270 - 320
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc |
48730565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 49073690 - 49073744
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||| |||| |
|
|
| T |
49073690 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccc |
49073744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 3679986 - 3679933
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccc |
3679933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 271 - 320
Target Start/End: Complemental strand, 7350733 - 7350684
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtcc |
7350684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 269 - 318
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 7867127 - 7867188
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
7867127 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaaa |
7867188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 12158690 - 12158743
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccc |
12158743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 20948755 - 20948808
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccc |
20948808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 21383430 - 21383369
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| ||||| |||| |||||||||||||| ||||| |||||||||| ||||| |
|
|
| T |
21383430 |
taggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgtaaa |
21383369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 317
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 37624745 - 37624798
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||| |||| |
|
|
| T |
37624745 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 40718474 - 40718421
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | |||||| |||||||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccc |
40718421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 270 - 327
Target Start/End: Complemental strand, 45368847 - 45368790
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgtaaa |
45368790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 15335292 - 15335236
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
15335236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 18899842 - 18899898
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaa |
18899898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 24978123 - 24978063
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||||||||||||||| || ||||| |
|
|
| T |
24978123 |
aggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgtaaa |
24978063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 315
Target Start/End: Complemental strand, 42483272 - 42483224
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
42483272 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 8364918 - 8364863
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||||| |||||||||||||| ||||| |
|
|
| T |
8364918 |
taggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccc |
8364863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 261 - 316
Target Start/End: Original strand, 15334910 - 15334965
Alignment:
| Q |
261 |
tttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||| ||||||||||||||||||| ||| ||| ||||||| ||||||||||||||| |
|
|
| T |
15334910 |
tttagtaggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 267 - 310
Target Start/End: Complemental strand, 18079661 - 18079618
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
310 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18079661 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 41739122 - 41739064
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
41739122 |
taggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgtaaa |
41739064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 422 - 481
Target Start/End: Original strand, 49923636 - 49923695
Alignment:
| Q |
422 |
tttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatc |
481 |
Q |
| |
|
||||||||||||||||||| ||||||| | |||| |||||||||| ||||||||||||| |
|
|
| T |
49923636 |
tttgcagggactatttttctaataaataggttcagtcatcatgtgctacatgtgcaaatc |
49923695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 49923820 - 49923765
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||| |||||||| |||||||||| |
|
|
| T |
49923820 |
taggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccc |
49923765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 318
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 33067346 - 33067400
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||| |||| |
|
|
| T |
33067346 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 39747473 - 39747526
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| | |||||||||||||||||||| |
|
|
| T |
39747473 |
aggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccc |
39747526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 261 - 321
Target Start/End: Original strand, 292854 - 292912
Alignment:
| Q |
261 |
tttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||| |||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
292854 |
tttaaaaggctaaaat--ggttttagtccctgcaaatatgcctcgttttgcttttagtccc |
292912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 271 - 320
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 389 - 434
Target Start/End: Complemental strand, 13770711 - 13770666
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggacta |
434 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
13770711 |
attttgcagggacctttttaaaaaacaaaatattttgcagggacta |
13770666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 18928141 - 18928084
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||| |||| ||||||||||| |||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtcccggtaa |
18928084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 26142418 - 26142471
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||| ||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
26142418 |
taggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtc |
26142471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 269 - 310
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttg |
310 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 26699608 - 26699556
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
26699608 |
taggctaaaatatggttttggtcc-tgcaaatatgcttcgtttttgttttagtc |
26699556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 260 - 321
Target Start/End: Original strand, 30962408 - 30962469
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
30962408 |
tttttataggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccc |
30962469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 264 - 309
Target Start/End: Complemental strand, 32035792 - 32035747
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgtttt |
309 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
32035792 |
aataggctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 33380257 - 33380204
Alignment:
| Q |
268 |
ggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| | |||| |||||||||||||||||||||||||||| |
|
|
| T |
33380257 |
ggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcc |
33380204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 271 - 320
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| |||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 4360627 - 4360567
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| |||||||| ||| ||||| |
|
|
| T |
4360627 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctgtaaa |
4360567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 263 - 319
Target Start/End: Original strand, 4617083 - 4617139
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||| ||||||||||||||| |||||| ||||||| ||||||| ||||||||| |
|
|
| T |
4617083 |
taataggttaaaatatggttttggtccctgaaaatatgtttcgttttagttttagtc |
4617139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 16083046 - 16083098
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| |||||||| ||||||||| |
|
|
| T |
16083046 |
aggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #250
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 287 - 327
Target Start/End: Original strand, 18302072 - 18302112
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
18302072 |
tccctgcaaatatgtctcgttttggttttagtccctgtaaa |
18302112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #251
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 21391371 - 21391323
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| ||||||||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtc |
21391323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #252
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 267 - 315
Target Start/End: Original strand, 34002634 - 34002682
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
|||||||| |||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
34002634 |
aggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #253
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 50428872 - 50428932
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||| ||||| |||| ||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgtaaa |
50428932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #254
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 1811049 - 1811092
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
1811049 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
1811092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #255
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 31404724 - 31404669
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| ||| |||||| | ||||||||||| |
|
|
| T |
31404724 |
taggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagtccc |
31404669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #256
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 39303774 - 39303817
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
39303774 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
39303817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #257
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 264 - 299
Target Start/End: Original strand, 46073881 - 46073916
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46073881 |
aataggctaaaatatgcttttgatccctgcaaatat |
46073916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #258
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 273 - 327
Target Start/End: Complemental strand, 4789639 - 4789585
Alignment:
| Q |
273 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| |||||||| ||||||||||||||| || |||||||||| ||||| ||||| |
|
|
| T |
4789639 |
aaatttggttttggtccctgcaaatatgcatcattttggttttggtccctgtaaa |
4789585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #259
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 281 - 315
Target Start/End: Complemental strand, 7350663 - 7350629
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7350663 |
ttttggtccctgcaaatatgcctcgttttggtttt |
7350629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #260
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 15466132 - 15466190
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| ||| | | ||||||||| |||||||||||||||| |||| |
|
|
| T |
15466132 |
ggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctgtaa |
15466190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #261
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 273 - 319
Target Start/End: Complemental strand, 16083394 - 16083348
Alignment:
| Q |
273 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| |||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtc |
16083348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #262
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 281 - 315
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28507188 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28507222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #263
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 432
Target Start/End: Complemental strand, 33380108 - 33380066
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
33380108 |
ttttgcagggacctttttaaaaaacaaaatattttgcagggac |
33380066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #264
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 269 - 319
Target Start/End: Original strand, 34382948 - 34382997
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| ||||||||||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtc |
34382997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #265
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 261 - 299
Target Start/End: Complemental strand, 46075116 - 46075078
Alignment:
| Q |
261 |
tttaataggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
46075116 |
tttaattggctaaaatatgtttttgatccctgcaaatat |
46075078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #266
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 320
Target Start/End: Original strand, 20756022 - 20756071
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||| |||| |||| || ||||||| ||||||||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtcc |
20756071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #267
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 29579322 - 29579379
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| |||| |||||||||| ||||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctgtaaa |
29579379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #268
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 389 - 434
Target Start/End: Original strand, 41358441 - 41358486
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggacta |
434 |
Q |
| |
|
|||||||| |||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
41358441 |
attttgcagggaccttttttaaaaacaaaatattttgcagggacta |
41358486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #269
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 315
Target Start/End: Complemental strand, 49074055 - 49074006
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
|||||||||||||||||||| ||| || |||||||| |||||||| |||| |
|
|
| T |
49074055 |
taggctaaaatatggttttggtccttgtaaatatgcttcgttttgatttt |
49074006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #270
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 388 - 432
Target Start/End: Complemental strand, 4324052 - 4324008
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||||| |||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
4324052 |
tattttgcagggaccttttttaaaaacaaaatattttgcagggac |
4324008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #271
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 10887306 - 10887346
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
10887306 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
10887346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #272
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 12360676 - 12360716
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||| |
|
|
| T |
12360676 |
ttttgatccctgcaaatatgtcccgttttggttttggtccc |
12360716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #273
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 26324874 - 26324834
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
26324874 |
ttttggtccctgcaaatatgtctcgttttggttttcgtccc |
26324834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #274
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 33234620 - 33234660
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||| |
|
|
| T |
33234620 |
ttttgatccctgcaaatatgtctcgttttgattttggtccc |
33234660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #275
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 287 - 327
Target Start/End: Original strand, 37646761 - 37646801
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
37646761 |
tccctgcaaatatgcttcgttttgattttagtccctgtaaa |
37646801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #276
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 46183757 - 46183797
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
46183757 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
46183797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #277
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 46868225 - 46868277
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||| |||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
46868225 |
aggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtc |
46868277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #278
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 388 - 432
Target Start/End: Original strand, 50428987 - 50429031
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||||| |||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
50428987 |
tattttgcagggaccttttttaaaaacaaaatattttgcagggac |
50429031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 68; Significance: 4e-30; HSPs: 4)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 189553 - 189458
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| || ||| |||||||||||| |
|
|
| T |
189553 |
tattttgcaacgacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcaatcatcatatgccacgtgtgcaaatcat |
189458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 265 - 318
Target Start/End: Original strand, 189326 - 189379
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
189326 |
ataggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagt |
189379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 61631 - 61685
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||| |||||| |||||||||| |
|
|
| T |
61631 |
aggctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccc |
61685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 267 - 316
Target Start/End: Complemental strand, 189679 - 189630
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
189679 |
aggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta |
189630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 68; Significance: 4e-30; HSPs: 6)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 48090 - 47995
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||| |||||| |||||||||||| |
|
|
| T |
48090 |
tattttgcaaggacctttttaaaaatcaaaagattttacagggactatttttctaataaatgggttcaatcatcaagtgtcaagtgtgcaaatcat |
47995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 47924 - 47978
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
47924 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
47978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 388 - 466
Target Start/End: Complemental strand, 223036 - 222958
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtg |
466 |
Q |
| |
|
||||||||| ||| |||||||| ||| || |||||||||| ||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
223036 |
tattttgcagggatctttttaagaataaagagattttgcatagactatttttctaataaatggattcactcatcatgtg |
222958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
48180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #5
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 223174 - 223120
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
223174 |
taggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 222884 - 222924
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
222884 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
222924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 4e-30; HSPs: 318)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 1721312 - 1721217
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||| |||||| ||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
1721312 |
tattttgcagggacgtttttacaaatcaaaagattttgcagggactatttttctaataaatgggttcactcatcatgtgccacatgtgcaaatcat |
1721217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 19844491 - 19844396
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
19844491 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcactcatcatgtgtcacgtgtgcaaatcat |
19844396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 20644730 - 20644635
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||| |||||| ||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
20644730 |
tattttgcagggacgtttttacaaatcaaaagattttgcagggactatttttctaataaatgggttcactcatcatgtgccacatgtgcaaatcat |
20644635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 38232383 - 38232478
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||| ||| |||||||| |
|
|
| T |
38232383 |
tattttgcagggatctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgtcacgtgtacaaatcat |
38232478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 389 - 495
Target Start/End: Original strand, 16679740 - 16679846
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataacca |
488 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||| ||||| |||| ||| |||||||||||| || | |
|
|
| T |
16679740 |
attttgcagggacctttttaaaaatcaaaagattttgtagggactatttttctaataaatgggttcagtcatcttgtgccacgtgtgcaaatcatcacaa |
16679839 |
T |
|
| Q |
489 |
aaatgag |
495 |
Q |
| |
|
||||||| |
|
|
| T |
16679840 |
aaatgag |
16679846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 399 - 483
Target Start/End: Complemental strand, 35177469 - 35177385
Alignment:
| Q |
399 |
gacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
35177469 |
gacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
35177385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 9261929 - 9262024
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
9261929 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
9262024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 400 - 483
Target Start/End: Complemental strand, 28418754 - 28418671
Alignment:
| Q |
400 |
acctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
28418754 |
acctttttaaaaatcaaaagattttgcagggactatttttctaattaatggattcagtcatcatgtgccacgtgtgcaaatcat |
28418671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 29686763 - 29686668
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| || | |||||||||| ||| ||| |||||||| |
|
|
| T |
29686763 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggtttagtcatcatgtgccacgtgttcaaatcat |
29686668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 35407664 - 35407569
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| ||| ||| |||||||| |
|
|
| T |
35407664 |
tattttgcaagaacctttttaaaaatcaaaagattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacctgtacaaatcat |
35407569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 35565733 - 35565638
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
35565733 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
35565638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 40278047 - 40277952
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
40278047 |
tattttgcagggacctttttaaaaatcaaaagattttgtagggactatttatctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
40277952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 47005379 - 47005284
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| ||||||||| ||| |||||||||||| |
|
|
| T |
47005379 |
tattttgcagggacctttttaaaaatcaaaagattttgcagggactattttttaaataaatgggttcggtcatcatgtaccacgtgtgcaaatcat |
47005284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 52342357 - 52342452
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||| |||||||||| ||| |||||||||||| |
|
|
| T |
52342357 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgaattcagtcatcatgtgccacgtgtgcaaatcat |
52342452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 3387490 - 3387395
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| || |||||||||||| |
|
|
| T |
3387490 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcactcatcatgtgccaagtgtgcaaatcat |
3387395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 4034942 - 4034847
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
4034942 |
tattttgtagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
4034847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 400 - 483
Target Start/End: Original strand, 39132694 - 39132777
Alignment:
| Q |
400 |
acctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||| ||||| |||||||||||| |
|
|
| T |
39132694 |
acctttttaaaaatcaaaagattttgcagggactatttttctaataaatgagttcagtcatcatgcgtcacgtgtgcaaatcat |
39132777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 398 - 483
Target Start/End: Original strand, 47114599 - 47114684
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| |||||||| ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
47114599 |
ggaccgttttaaaaatcaaaagattttgctgggattatttttctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
47114684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 9603626 - 9603682
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9603626 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
9603682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 22016184 - 22016275
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
22016184 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
22016275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 54608742 - 54608651
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
54608742 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
54608651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 7957002 - 7957097
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| | || ||||||| ||||||| | |||| |||||||||| ||| |||||||||||| |
|
|
| T |
7957002 |
tattttgcagggacctttttaaaaatcaaaagattttgcaagaaccatttttctaataaattggttcagtcatcatgtgccacgtgtgcaaatcat |
7957097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 8555083 - 8555178
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||| | |||| || || |||| ||| |||||||||||| |
|
|
| T |
8555083 |
tattttgcagggacctttttaaaaatcaaaagattttgcaaggactatttttctaataaattggttcagtcgtcgtgtgacacgtgtgcaaatcat |
8555178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 9596870 - 9596965
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||| |||||||||||||||||||||||| ||||||| ||||||||| |||| |||||||||| ||| | |||||||||| |
|
|
| T |
9596870 |
tattttgcagggatctttttcaaaatcaaaagattttgcagggaccatttttctaataaatgggttcagtcatcatgtgccacgtatgcaaatcat |
9596965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 25609906 - 25610001
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||| |||||| ||||||||| |||| |||||||||| ||| ||| |||||||| |
|
|
| T |
25609906 |
tattttgcagggacctttttaaaaatcaaaagattttgcaatgactgtttttctaataaatgggttcagtcatcatgtgccacgtgttcaaatcat |
25610001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 30034247 - 30034342
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || |||||| | |||| |||||||||| ||| |||||||||||| |
|
|
| T |
30034247 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctgataaattggttcagtcatcatgtgccacgtgtgcaaatcat |
30034342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 44802389 - 44802484
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||| | |||| |||| |||||||| |||||||||||| |
|
|
| T |
44802389 |
tattttgcaaagacctttttaaaaatcaaaagattttgcaaggactatttttctaataaataggttcagtcattatgtgtcatgtgtgcaaatcat |
44802484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 53113608 - 53113513
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||| |||||||||||| ||||||| | |||| |||||||||| || |||||||||||| |
|
|
| T |
53113608 |
tattttgcagggacttttttaaaaatcaaaagattttgcaaggactatttttctaataaataggttcagtcatcatgtgccatgtgtgcaaatcat |
53113513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 265 - 323
Target Start/End: Complemental strand, 9262158 - 9262100
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccg |
323 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9262158 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccccg |
9262100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 43441604 - 43441550
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43441604 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
43441550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 260 - 318
Target Start/End: Original strand, 45002013 - 45002071
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45002013 |
ttttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
45002071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 474184 - 474275
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||| |||| | |||||||||| ||| ||||||||| |
|
|
| T |
474184 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaat-gattaagtcatcatgtgacacgtgtgcaaat |
474275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 8940301 - 8940392
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
8940301 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
8940392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 12741131 - 12741040
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
12741131 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
12741040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 15979562 - 15979471
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||| ||||| |
|
|
| T |
15979562 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtacaaat |
15979471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 22008666 - 22008757
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
22008666 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
22008757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 28552159 - 28552250
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||| | || | |||||||||| ||||||||||||| |
|
|
| T |
28552159 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatag-ttaagtcatcatgtgacacatgtgcaaat |
28552250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 31480135 - 31480195
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31480135 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
31480195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 47336452 - 47336361
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||| ||||| |
|
|
| T |
47336452 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtacaaat |
47336361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 49323922 - 49324013
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
49323922 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
49324013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 51550306 - 51550215
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
51550306 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
51550215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 403 - 483
Target Start/End: Original strand, 53719117 - 53719197
Alignment:
| Q |
403 |
tttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| | ||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
53719117 |
tttttaaaaatcaaaatattttgcagggactatttttctacaaaatggattcagtcatcatgtatcacgtgtgcaaatcat |
53719197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 14772437 - 14772342
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| | |||||||||||| | |||||| ||||||||||||||| ||| ||| |||||||| |
|
|
| T |
14772437 |
tattttgcagggacctttttaaaaatcaaaatattttgtatggactatttttccacaaaatgggttcaatcatcatgtgccacgtgtacaaatcat |
14772342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 25615974 - 25616033
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25615974 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25616033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 28552385 - 28552330
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28552385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
28552330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 400 - 483
Target Start/End: Original strand, 29678174 - 29678257
Alignment:
| Q |
400 |
acctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||| || | ||||| |||| ||| |||||||||||| |
|
|
| T |
29678174 |
acctttttaaaaatcaaaagattttgcaggcactatttttctaataaatgggtttagtcatcttgtgccacgtgtgcaaatcat |
29678257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 35936900 - 35936995
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||| ||||||||||| |||||||| |||| ||||||| | |||| |||||||||||| |
|
|
| T |
35936900 |
tattttgcagagacctttttaaaaattaaaagattttgcagagactatttttctgataaatgggttcattcatcatctatcacgtgtgcaaatcat |
35936995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 39288900 - 39288845
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39288900 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccc |
39288845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 268 - 323
Target Start/End: Complemental strand, 40370589 - 40370534
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccg |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccccg |
40370534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 486
Target Start/End: Original strand, 46621903 - 46622002
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatg-gattcaatcatcatgtgtcacatgtgcaaatcataac |
486 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||| ||||||||||||||| |||||||| | || ||||||||||||| ||||||||||||||| |
|
|
| T |
46621903 |
tattttgtagggacctttttaaaaatcaaaagattttacagggactatttttctaataaatgagtgacagtcatcatgtgtcatgtgtgcaaatcataac |
46622002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 49323782 - 49323841
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
49323841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 51550080 - 51550135
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51550080 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
51550135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 260 - 327
Target Start/End: Complemental strand, 54608871 - 54608804
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
54608871 |
tttttataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
54608804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 54767395 - 54767301
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||||||||||||| ||||| ||| ||||| |||| |||||||||||||| || ||||||||| |
|
|
| T |
54767395 |
tattttgtagggacctttttaaaaatcaaaatattttgcagggacta-ttttctaatgaatgggttcagtcatcatgtgtcacgtgagcaaatcat |
54767301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 388 - 466
Target Start/End: Original strand, 29490518 - 29490596
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtg |
466 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||||| |||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
29490518 |
tattttgcagggacctttttggaaaccaaaagattttgtagggactatttttcaaataaatgggttcagtcatcatgtg |
29490596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 265 - 327
Target Start/End: Complemental strand, 47336584 - 47336522
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
47336584 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
47336522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 54608517 - 54608571
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608517 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
54608571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 388 - 485
Target Start/End: Original strand, 863427 - 863524
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataa |
485 |
Q |
| |
|
||||||||| | |||||||| ||||||||||||||||||||||||||||| | ||||||||| | || |||||||||| || |||||||||||||| |
|
|
| T |
863427 |
tattttgcaggaacctttttgaaaatcaaaagattttgcagggactatttcttaaataaatgagtccagtcatcatgtgccatgtgtgcaaatcataa |
863524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 22008890 - 22008837
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
22008837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 28552019 - 28552080
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
28552019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaaa |
28552080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 265 - 326
Target Start/End: Complemental strand, 30106223 - 30106162
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
30106223 |
ataggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaa |
30106162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 260 - 321
Target Start/End: Original strand, 37506859 - 37506920
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37506859 |
ttttcataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
37506920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 46751270 - 46751323
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751270 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
46751323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 51550448 - 51550387
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
51550448 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
51550387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 1721453 - 1721393
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
1721453 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
1721393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 4513262 - 4513322
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4513262 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
4513322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 4950036 - 4950096
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4950036 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
4950096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 9597096 - 9597036
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
9597096 |
aggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgtaaa |
9597036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 12741272 - 12741212
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
12741272 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
12741212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 19844582 - 19844522
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
19844582 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaa |
19844522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 32119360 - 32119451
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
32119360 |
tattttgtagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
32119451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 45002245 - 45002154
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||| ||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
45002245 |
tattttgcagggatcttttacaaaatcaaaagattttgcagggactatttatctaataaatgg-ttcagtcatcatgtgccacgtgtgcaaat |
45002154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 45002386 - 45002326
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45002386 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaa |
45002326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 45006109 - 45006016
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||| || ||||| |||||||| |||||||||| |||||||| || ||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
45006109 |
tattttgcatgaacttttttcaaaatcaa--gattttgcagagactatttctctaataaatgggttcagtcatcatgtgtcacgtgtgcaaatcat |
45006016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 48924241 - 48924181
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
48924241 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaaa |
48924181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 3151748 - 3151803
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3151748 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
3151803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 3152113 - 3152058
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3152113 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
3152058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 4034717 - 4034776
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
4034776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 9261789 - 9261848
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
9261848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 12740905 - 12740960
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
12740905 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
12740960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 14772210 - 14772269
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
14772210 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcccggtaa |
14772269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 25710870 - 25710811
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
25710811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 26090078 - 26090019
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
26090019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 260 - 319
Target Start/End: Complemental strand, 29490751 - 29490692
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
29490751 |
ttttactaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29490692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 30034476 - 30034413
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
30034476 |
aataggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgtaaa |
30034413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 35407794 - 35407731
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||| ||||| |
|
|
| T |
35407794 |
aataggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgtaaa |
35407731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 35565507 - 35565566
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
35565507 |
aggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgtaa |
35565566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 393 - 480
Target Start/End: Complemental strand, 43441489 - 43441403
Alignment:
| Q |
393 |
tgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| || | |||||||||| ||| ||||||||| |
|
|
| T |
43441489 |
tgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttaagtcatcatgtgacacgtgtgcaaat |
43441403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 46724683 - 46724778
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | ||||||||| ||||||||||||||||||||| ||||||||||| ||| ||||| |||| |||||||||| ||| ||| ||||||| |
|
|
| T |
46724683 |
tattttggagggaccttttcaaaaatcaaaagattttgcagagactatttttctaatgaatgggttcagtcatcatgtgacacgtgtttaaatcat |
46724778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 50009145 - 50009050
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||| |||||||||||| |||||||| || | |||||||| ||| |||||||||||| |
|
|
| T |
50009145 |
tattttgcaggaacctttttaaaaatcaaaagattttgcatggactatttttctaataaatgagtttggtaatcatgtgccacgtgtgcaaatcat |
50009050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 474043 - 474097
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
474043 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
474097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 3387268 - 3387318
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccc |
3387318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 3830518 - 3830464
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3830518 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3830464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 8940522 - 8940472
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
8940472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 409 - 483
Target Start/End: Complemental strand, 9603833 - 9603759
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
9603833 |
aaaatcaaaagattttgcagggactatttctctaataaatgagttcagtcatcatgtgacacgtgtgcaaatcat |
9603759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 10977342 - 10977288
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10977342 |
aggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccc |
10977288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 11463233 - 11463291
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgtaaa |
11463291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 20612899 - 20612845
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20612899 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
20612845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 28427609 - 28427555
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28427609 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
28427555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 32119585 - 32119531
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32119585 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccc |
32119531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 37507223 - 37507169
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37507223 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
37507169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 39437110 - 39437056
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39437110 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
39437056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 47005521 - 47005467
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
47005521 |
taggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc |
47005467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 47336227 - 47336281
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47336227 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
47336281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 51834607 - 51834661
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51834607 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
51834661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 265 - 318
Target Start/End: Complemental strand, 474411 - 474358
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
474411 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
474358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 3387605 - 3387552
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
3387605 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 3830132 - 3830193
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
3830132 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
3830193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 10976978 - 10977031
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
10977031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 15979338 - 15979391
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
15979391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 15979703 - 15979642
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
15979703 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaa |
15979642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 21159819 - 21159758
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
21159819 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
21159758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 26089730 - 26089783
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
26089783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 260 - 321
Target Start/End: Original strand, 26799880 - 26799941
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||| |||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
26799880 |
ttttaaaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
26799941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 31480500 - 31480447
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccc |
31480447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 50196301 - 50196358
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
50196358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 415 - 483
Target Start/End: Original strand, 2486704 - 2486772
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
2486704 |
aaaatattttgcagggactatttttctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
2486772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 262 - 318
Target Start/End: Complemental strand, 4035059 - 4035003
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
4035059 |
ttaattggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagt |
4035003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 4513621 - 4513561
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
4513621 |
aggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaaa |
4513561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 5345690 - 5345630
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
5345690 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
5345630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 271 - 327
Target Start/End: Original strand, 8940163 - 8940219
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaaa |
8940219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 21553888 - 21553948
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
21553888 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgtaaa |
21553948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 22008525 - 22008585
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
22008525 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
22008585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 22016043 - 22016103
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
22016043 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
22016103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 269 - 321
Target Start/End: Complemental strand, 22156292 - 22156240
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
22156240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 30268504 - 30268564
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30268504 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
30268564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 31480276 - 31480367
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| ||||||||| || |||||| || |||| |||||||||| ||| ||||||||| |
|
|
| T |
31480276 |
tattttgcagggaccttttacaaaatcaaaagattttgcaaggactatttctctaataaa-gggttcagtcatcatgtgccacgtgtgcaaat |
31480367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 35569133 - 35569077
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
35569077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 415 - 483
Target Start/End: Complemental strand, 36732836 - 36732768
Alignment:
| Q |
415 |
aaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| ||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
36732836 |
aaaatattttgcagggactatttttctaataactgggttcagtcatcatgtgccacatgtgcaaatcat |
36732768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 326
Target Start/End: Original strand, 40545562 - 40545622
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| ||||||||||| |||| |
|
|
| T |
40545562 |
taggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaa |
40545622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 40979711 - 40979651
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
40979711 |
aggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgtaaa |
40979651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 45320980 - 45320920
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45320980 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
45320920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 265 - 316
Target Start/End: Complemental strand, 9603922 - 9603871
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
9603922 |
ataggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 9863404 - 9863345
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaa |
9863345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 319
Target Start/End: Complemental strand, 20907461 - 20907406
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
20907461 |
aataggttaaaatatggttttaatccctgcaaatatgcctcattttggttttagtc |
20907406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 269 - 320
Target Start/End: Complemental strand, 25610129 - 25610078
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
25610078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 27681542 - 27681447
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||||||||| ||||||||||||| ||||||||| ||| |||||| |||||| |||||||||||| |
|
|
| T |
27681542 |
tattttgcagtgacctttctaaaaattaaaagattttgtagggactatttttataataaatgggttcggtcatcacatgtcacgtgtgcaaatcat |
27681447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 28452378 - 28452323
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
28452378 |
taggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccc |
28452323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 30105996 - 30106090
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||| ||||| ||||| ||| ||||| |||| |||||||||| | | ||||| |||||| |
|
|
| T |
30105996 |
tattttggagggacctttttaaaaatcaaaagattttgcagcgactacttttctaat-aatgggttcactcatcatgtgccgcgtgtgctaatcat |
30106090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 47005153 - 47005212
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| ||||||||||| |||| |
|
|
| T |
47005153 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgtaa |
47005212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 50196661 - 50196598
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
50196661 |
aataggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgtaaa |
50196598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 51834944 - 51834889
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51834944 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
51834889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 326
Target Start/End: Complemental strand, 7957226 - 7957168
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgtaa |
7957168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 13584368 - 13584314
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13584368 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccc |
13584314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 409 - 483
Target Start/End: Original strand, 20405019 - 20405093
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||| ||||| |||||||||||||||||| || ||||||||| |||| |||||||||||||| | |||||||||| |
|
|
| T |
20405019 |
aaaaacaaaatattttgcagggactatttctctaataaatgggttcagtcatcatgtgtcacgtatgcaaatcat |
20405093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 28942906 - 28942852
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
28942906 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccc |
28942852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 29445954 - 29446012
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29446012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 30130155 - 30130217
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
30130155 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaa |
30130217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 34238596 - 34238650
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
34238596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 39436717 - 39436771
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
39436717 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
39436771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 40169343 - 40169397
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
40169343 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccc |
40169397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 318
Target Start/End: Original strand, 43441270 - 43441320
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
43441320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 45005889 - 45005939
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccc |
45005939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 326
Target Start/End: Complemental strand, 45313863 - 45313805
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaa |
45313805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 51500686 - 51500632
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
51500632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 316
Target Start/End: Original strand, 52342193 - 52342243
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
52342193 |
taggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 326
Target Start/End: Complemental strand, 53701663 - 53701605
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
53701605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 7588316 - 7588369
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
7588316 |
taggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc |
7588369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 8510214 - 8510267
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccc |
8510267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 15016388 - 15016441
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccc |
15016441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 16123139 - 16123192
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccc |
16123192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 265 - 326
Target Start/End: Complemental strand, 27681685 - 27681624
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| || || ||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
27681685 |
ataggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgtaa |
27681624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 28427241 - 28427298
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |||||||||||||||||||| |
|
|
| T |
28427241 |
aataggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccc |
28427298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 265 - 318
Target Start/End: Original strand, 28942522 - 28942575
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
28942522 |
ataggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 29955300 - 29955357
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaa |
29955357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 29955668 - 29955607
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
29955668 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
29955607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 30004454 - 30004511
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaa |
30004511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 30004823 - 30004762
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
30004823 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaa |
30004762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 30128282 - 30128343
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| ||||||||||||||||| || ||||| |
|
|
| T |
30128282 |
taggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgtaaa |
30128343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 31869596 - 31869653
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgtaaa |
31869653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 31869958 - 31869897
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
31869958 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaa |
31869897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 52342584 - 52342531
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
52342584 |
aggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc |
52342531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 265 - 321
Target Start/End: Original strand, 275441 - 275497
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
275441 |
ataggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccc |
275497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 12673643 - 12673703
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
12673643 |
aggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgtaaa |
12673703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 20611019 - 20611071
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
20611019 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 39288572 - 39288624
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
39288572 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Complemental strand, 46186772 - 46186720
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
46186772 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
46186720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 47114486 - 47114538
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
47114486 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 49324149 - 49324093
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| ||||||||||||||| |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
49324149 |
ataggataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccc |
49324093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 270 - 317
Target Start/End: Original strand, 14633547 - 14633594
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
317 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
14633594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 19844265 - 19844324
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |||||||||| ||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgtaaa |
19844324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 22155927 - 22155982
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
22155927 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccc |
22155982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 320
Target Start/End: Complemental strand, 29446209 - 29446154
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
29446209 |
ataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
29446154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 29678023 - 29678082
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29678023 |
aggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgtaa |
29678082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 319
Target Start/End: Complemental strand, 29686870 - 29686819
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
29686870 |
ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagtc |
29686819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 32119218 - 32119273
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
32119218 |
taggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccc |
32119273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 318
Target Start/End: Original strand, 35177254 - 35177305
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
35177254 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 35936779 - 35936838
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| | |||||||||||||| ||||||||| |
|
|
| T |
35936779 |
aggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccccgtaa |
35936838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 40277821 - 40277880
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
40277821 |
aggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgtaa |
40277880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 44802282 - 44802341
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||| || ||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgtaaa |
44802341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 46622131 - 46622076
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
46622131 |
taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccc |
46622076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 420 - 483
Target Start/End: Original strand, 52956507 - 52956570
Alignment:
| Q |
420 |
attttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||| |||||||||||||| |||| ||||||| |
|
|
| T |
52956507 |
attttgcagggactatttctctaataaatgggttcagtcatcatgtgtcacgtgtgtaaatcat |
52956570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 270 - 316
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 269 - 319
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 9596759 - 9596817
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgtaaa |
9596817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 13514579 - 13514525
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
13514579 |
taggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc |
13514525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 388 - 462
Target Start/End: Complemental strand, 19297813 - 19297739
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatca |
462 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| ||| | |||||||| |||||| || |||| |||||| |
|
|
| T |
19297813 |
tattttgcagggacctttttaaaaatcaaatgattttgtaggaaatatttttctaataaaagggttcagtcatca |
19297739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 20757403 - 20757453
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccc |
20757453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 28452145 - 28452199
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| || |||||||||||||||| |
|
|
| T |
28452145 |
taggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc |
28452199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 262 - 320
Target Start/End: Complemental strand, 34238921 - 34238863
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||| |||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
34238921 |
ttaaaaggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 269 - 327
Target Start/End: Complemental strand, 36673244 - 36673186
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || ||||||||||||| |||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagttcccgtaaa |
36673186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 316
Target Start/End: Original strand, 4814539 - 4814588
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4814539 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 7518089 - 7518142
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||| |||||||||| |
|
|
| T |
7518089 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc |
7518142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 271 - 320
Target Start/End: Complemental strand, 8555305 - 8555256
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc |
8555256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 19656540 - 19656593
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
19656540 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc |
19656593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 20405225 - 20405164
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| | | ||||| ||||||||||| ||||| |
|
|
| T |
20405225 |
taggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgtaaa |
20405164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 20757777 - 20757724
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| |||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
20757777 |
taggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtc |
20757724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 21159452 - 21159505
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
21159452 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
21159505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 25609765 - 25609826
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| || | |||||| |||||||||||||||||||||| ||||| |
|
|
| T |
25609765 |
taggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgtaaa |
25609826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 25710508 - 25710569
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
25710508 |
taggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaa |
25710569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 29525104 - 29525157
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
29525104 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 38232240 - 38232293
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
38232240 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc |
38232293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 40169654 - 40169601
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccc |
40169601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 424 - 493
Target Start/End: Original strand, 40370399 - 40370468
Alignment:
| Q |
424 |
tgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcataaccaaaatg |
493 |
Q |
| |
|
|||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| || |||||| |
|
|
| T |
40370399 |
tgcagggactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcatcacaaaaatg |
40370468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 312
Target Start/End: Complemental strand, 44802549 - 44802504
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
312 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
44802549 |
aggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 270 - 327
Target Start/End: Complemental strand, 45006247 - 45006190
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaa |
45006190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 863649 - 863593
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgtaaa |
863593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 326
Target Start/End: Original strand, 1721087 - 1721147
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
1721087 |
taggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgtaa |
1721147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 326
Target Start/End: Original strand, 4321944 - 4322004
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| ||| ||||||||||| |||| |||| |
|
|
| T |
4321944 |
taggctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctgtaa |
4322004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 4322186 - 4322130
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||| |||||| |||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaa |
4322130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 270 - 318
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 318
Target Start/End: Original strand, 20404888 - 20404940
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||| |||||||||| |
|
|
| T |
20404888 |
taggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagt |
20404940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 20644877 - 20644817
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| |||||| |||||| || ||||||| |||||||||| ||||| |
|
|
| T |
20644877 |
aggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgtaaa |
20644817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 263 - 319
Target Start/End: Original strand, 51500393 - 51500449
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||| | || ||| |||||||||||||||||||||||||| |
|
|
| T |
51500393 |
taataggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 51759818 - 51759878
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||| | | |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
51759818 |
aggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaaa |
51759878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 269 - 317
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
317 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 267 - 315
Target Start/End: Original strand, 53113442 - 53113490
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
315 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
53113442 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 9863045 - 9863099
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| |||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9863045 |
taggttaaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccc |
9863099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 267 - 326
Target Start/End: Original strand, 29686543 - 29686602
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||| |||||||||||| ||| |||||||||| || ||||||||||||||||| |||| |
|
|
| T |
29686543 |
aggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgtaa |
29686602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 39072213 - 39072154
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgtaaa |
39072154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 40370285 - 40370344
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||| |||||||| || ||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgtaaa |
40370344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 271 - 326
Target Start/End: Complemental strand, 40545836 - 40545781
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
40545781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 269 - 320
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
46186461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 53701361 - 53701420
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
53701361 |
ggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgtaaa |
53701420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 4814899 - 4814846
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
4814899 |
aggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccc |
4814846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 319
Target Start/End: Complemental strand, 11463480 - 11463430
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| | || ||||||| |||||||||||||||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtc |
11463430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 14633890 - 14633836
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
14633890 |
aggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccc |
14633836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 326
Target Start/End: Original strand, 20644505 - 20644563
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||| ||||| |||||||||| |||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgtaa |
20644563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 316
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 322
Target Start/End: Complemental strand, 30426226 - 30426173
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcccc |
322 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtcccc |
30426173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 30552479 - 30552425
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
30552479 |
aggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccc |
30552425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 265 - 319
Target Start/End: Original strand, 36672960 - 36673014
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||| ||||||||||||||| || ||||||||||| || ||||||||||||||| |
|
|
| T |
36672960 |
ataggataaaatatggttttggtctctgcaaatatgtcttgttttggttttagtc |
36673014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 43440494 - 43440548
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
43440494 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccc |
43440548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 320
Target Start/End: Complemental strand, 43440785 - 43440735
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 318
Target Start/End: Original strand, 46901096 - 46901154
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||| |||||||||||||||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
46901096 |
tttttataggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 49670803 - 49670749
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccc-tgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccc |
49670749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 326
Target Start/End: Complemental strand, 50009284 - 50009226
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||||||||||||| ||||| |||| |||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgtaa |
50009226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 863279 - 863332
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||| |||||||| ||||||||| |
|
|
| T |
863279 |
taggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtc |
863332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 28418899 - 28418842
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | |||||| |||||||||| |||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgtaa |
28418842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 268 - 317
Target Start/End: Complemental strand, 29678387 - 29678338
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
317 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttag |
29678338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 30130505 - 30130452
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||| |||||||||||| || ||||||||||||||| ||||||||||||||| |
|
|
| T |
30130505 |
aggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 254 - 327
Target Start/End: Original strand, 35498402 - 35498475
Alignment:
| Q |
254 |
tatcagttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||| |||| |||||||||||||||| ||| ||||| |||||||| |||||||||||||| |||| ||||| |
|
|
| T |
35498402 |
tatcatttttgataggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctgtaaa |
35498475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 46724545 - 46724602
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
46724545 |
ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctgtaaa |
46724602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 46724901 - 46724844
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| | |||||| |||||||||| |||| |
|
|
| T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgtaa |
46724844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 269 - 310
Target Start/End: Complemental strand, 53113757 - 53113716
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttg |
310 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
53113757 |
gctaaaatatggttttgatccatgcaaatatacctcgttttg |
53113716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 270 - 318
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 20644578 - 20644618
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
20644578 |
ttttgatccctgcaaatatgtctcgttttggttttggtccc |
20644618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 35177563 - 35177507
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| || ||||||||||| |||| ||||| |
|
|
| T |
35177563 |
taaaatatggttttcatccttgcaaatatgcttccttttggttttaatccctgtaaa |
35177507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 39132908 - 39132848
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || | ||||||| |||||| |||| |
|
|
| T |
39132908 |
taggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctgtaa |
39132848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 271 - 319
Target Start/End: Original strand, 45161116 - 45161164
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtc |
45161164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 54767524 - 54767468
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||||| ||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgtaaa |
54767468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 275833 - 275774
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| |||||||||||||||| || ||||| |
|
|
| T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagttccagtaaa |
275774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 289 - 320
Target Start/End: Original strand, 590197 - 590228
Alignment:
| Q |
289 |
cctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
590197 |
cctgcaaatatgcctcgttttggttttagtcc |
590228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 3830353 - 3830310
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
3830353 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
3830310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 5048238 - 5048195
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
5048238 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
5048195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #267
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 274 - 321
Target Start/End: Complemental strand, 8510523 - 8510476
Alignment:
| Q |
274 |
aatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccc |
8510476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #268
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 15016525 - 15016568
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
15016525 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
15016568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #269
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 20124890 - 20124847
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
20124890 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
20124847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #270
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 267 - 310
Target Start/End: Original strand, 25353198 - 25353241
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
310 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25353198 |
aggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #271
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 278 - 321
Target Start/End: Complemental strand, 25610061 - 25610018
Alignment:
| Q |
278 |
tggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttttggtccc |
25610018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #272
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 480
Target Start/End: Complemental strand, 26089933 - 26089863
Alignment:
| Q |
409 |
aaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
|||| ||||| |||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||| ||||| |
|
|
| T |
26089933 |
aaaaacaaaatattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtacaaat |
26089863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #273
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 30268704 - 30268661
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
30268704 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
30268661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #274
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 319
Target Start/End: Original strand, 30424628 - 30424679
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || ||||| ||||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtc |
30424679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #275
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 270 - 317
Target Start/End: Original strand, 35533281 - 35533328
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
317 |
Q |
| |
|
|||||||||||||||| || ||||||||||| || ||||||||||||| |
|
|
| T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggttttag |
35533328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #276
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 398 - 429
Target Start/End: Complemental strand, 35533482 - 35533451
Alignment:
| Q |
398 |
ggacctttttaaaaatcaaaagattttgcagg |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35533482 |
ggacctttttaaaaatcaaaagattttgcagg |
35533451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #277
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 264 - 299
Target Start/End: Complemental strand, 39820667 - 39820632
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39820667 |
aataggctaaaatatggttttggtccctgcaaatat |
39820632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #278
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 46186548 - 46186591
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
46186548 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
46186591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #279
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 53701581 - 53701538
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
53701581 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
53701538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #280
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 272 - 318
Target Start/End: Complemental strand, 21971046 - 21971000
Alignment:
| Q |
272 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||| ||| || |||||||||||||||||| ||||||| |
|
|
| T |
21971046 |
aaaatatggttttaatctctacaaatatgcctcgttttgattttagt |
21971000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #281
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 272 - 318
Target Start/End: Complemental strand, 21993482 - 21993436
Alignment:
| Q |
272 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||| ||| || |||||||||||||||||| ||||||| |
|
|
| T |
21993482 |
aaaatatggttttaatctctacaaatatgcctcgttttgattttagt |
21993436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #282
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 276 - 326
Target Start/End: Original strand, 29490377 - 29490427
Alignment:
| Q |
276 |
tatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||| ||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
29490377 |
tatggttttggtccctacaaatatgcaccgttttggttttagtccctgtaa |
29490427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #283
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 255 - 321
Target Start/End: Original strand, 30552134 - 30552199
Alignment:
| Q |
255 |
atcagttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| ||||| |||| |||||||||||||| | |||||||||||| || ||||||||||||||||| |
|
|
| T |
30552134 |
atcatttttattaggttaaaatatggtttt-agacctgcaaatatgtcttgttttggttttagtccc |
30552199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #284
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 432
Target Start/End: Complemental strand, 30552365 - 30552323
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
30552365 |
ttttgcagggacctttttaaaaaacaaaatattttgcagggac |
30552323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #285
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 34582523 - 34582577
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
34582523 |
aggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccc |
34582577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #286
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 281 - 319
Target Start/End: Original strand, 35565581 - 35565619
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagtc |
35565619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #287
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 270 - 316
Target Start/End: Original strand, 46621778 - 46621824
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
46621778 |
ctaaaatattgttttgatcccagcaaatatgcctcattttagtttta |
46621824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #288
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 47901803 - 47901853
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| || ||| |||||||| ||||||||||||||||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc |
47901853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #289
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 299
Target Start/End: Original strand, 976778 - 976811
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
976778 |
taggctaaaatatgcttttgatccctgcaaatat |
976811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #290
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 4705681 - 4705734
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | |||| |||||| ||||| |
|
|
| T |
4705681 |
ggctaaaatatgcttttgatccctgcaaatatggcgagtttaggttttggtccc |
4705734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #291
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 483
Target Start/End: Original strand, 11463298 - 11463351
Alignment:
| Q |
430 |
gactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
|||||||| || ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
11463298 |
gactatttctctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
11463351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #292
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 270 - 327
Target Start/End: Complemental strand, 14772523 - 14772466
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| | | ||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctgtaaa |
14772466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #293
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 389 - 430
Target Start/End: Complemental strand, 14783969 - 14783928
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcaggg |
430 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||| |
|
|
| T |
14783969 |
attttgcagggacctttttaaaaaacaaaatattttgcaggg |
14783928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #294
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 289 - 318
Target Start/End: Complemental strand, 16123481 - 16123452
Alignment:
| Q |
289 |
cctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16123481 |
cctgcaaatatgcctcgttttggttttagt |
16123452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #295
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 270 - 319
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||||| ||| || |||||||| ||||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #296
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 299
Target Start/End: Complemental strand, 20585705 - 20585672
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
20585705 |
taggctaaaatatgtttttgatccctgcaaatat |
20585672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #297
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 274 - 319
Target Start/End: Complemental strand, 38232594 - 38232549
Alignment:
| Q |
274 |
aatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggtttcagtc |
38232549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #298
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 299
Target Start/End: Complemental strand, 47433870 - 47433837
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
47433870 |
taggctaaaatatggttttggtccctgcaaatat |
47433837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #299
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 47902145 - 47902092
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||| ||||| |||| |||||||||| | ||||||||||||||||| |
|
|
| T |
47902145 |
ggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccc |
47902092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #300
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 277 - 318
Target Start/End: Complemental strand, 52956691 - 52956650
Alignment:
| Q |
277 |
atggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||| || |||||||||||| |||||||||||||||| |
|
|
| T |
52956691 |
atggttttggtctctgcaaatatgcatcgttttggttttagt |
52956650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #301
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 1721160 - 1721200
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||| ||||| |
|
|
| T |
1721160 |
ttttgatccctgcaaatatgtctcgttttagttttggtccc |
1721200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #302
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 3387338 - 3387378
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
3387338 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
3387378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #303
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 4034790 - 4034830
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
4034790 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
4034830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #304
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 7957154 - 7957114
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
7957154 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
7957114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #305
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 8555235 - 8555195
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
8555235 |
ttttgatccctgcaaatatgtcttgttttggttttggtccc |
8555195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #306
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 9262081 - 9262041
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
9262081 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
9262041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #307
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 293 - 321
Target Start/End: Complemental strand, 10778706 - 10778678
Alignment:
| Q |
293 |
caaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10778706 |
caaatatgcctcgttttggttttagtccc |
10778678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #308
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 18175791 - 18175848
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| ||||||||| |||| ||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctgtaaa |
18175848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #309
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 287 - 327
Target Start/End: Complemental strand, 33794787 - 33794747
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
33794787 |
tccctgcaaatatgcctcgttttaattttagtccctgtaaa |
33794747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #310
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 34588220 - 34588164
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34588220 |
ataggctaaaatatgacattgatccctgcaaatatgttcagttttggttttagtccc |
34588164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #311
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 39132834 - 39132794
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
39132834 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
39132794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #312
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 40370515 - 40370475
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
40370515 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
40370475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #313
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 287 - 327
Target Start/End: Original strand, 40560493 - 40560533
Alignment:
| Q |
287 |
tccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
40560493 |
tccctgcaaatatgcctcgttttaattttagtccctgtaaa |
40560533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #314
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 271 - 319
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||| ||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #315
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 45005959 - 45005999
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
45005959 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
45005999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #316
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 269 - 321
Target Start/End: Original strand, 50008921 - 50008973
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||| |||||||||||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggttttagtccc |
50008973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #317
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 52342509 - 52342469
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
52342509 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
52342469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #318
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 52956627 - 52956587
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
52956627 |
ttttggtccctgcaaatatgcctcattttggttttggtccc |
52956587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 64; Significance: 9e-28; HSPs: 3)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 2520 - 2425
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||| |||||||||| ||||||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
2520 |
tattttgcaggcacctttttaaaaatcaaaagattttgcaggcactatttttctaataaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
2425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 2662 - 2607
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2662 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccc |
2607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 263 - 316
Target Start/End: Original strand, 2329 - 2382
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
2329 |
taataggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 64; Significance: 9e-28; HSPs: 4)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 21915 - 21820
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||| ||||||| | ||||||||||| ||| ||| |||||||||||| |
|
|
| T |
21915 |
tattttgcagggaccttttttaaaatcaaaagattttgcagggactatttttctaataaattggttcaatcatcacgtgccacgtgtgcaaatcat |
21820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 22056 - 22003
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
22056 |
aggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc |
22003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 267 - 300
Target Start/End: Original strand, 21695 - 21728
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21695 |
aggctaaaatatggttttgatccctgcaaatatg |
21728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 21763 - 21803
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
21763 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
21803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 60; Significance: 2e-25; HSPs: 3)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 388 - 483
Target Start/End: Original strand, 34861 - 34955
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||| ||||||| || ||||||||| |||| |||||||||||||||| |||||||||| |
|
|
| T |
34861 |
tattttgcaggaacctttttaaaaatcaaaagattttgcagg-actatttatctaataaatgggttcagtcatcatgtgtcacatatgcaaatcat |
34955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 35086 - 35026
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| |||||||||||||||||||| |||| |
|
|
| T |
35086 |
taggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgtaa |
35026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 35012 - 34972
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| ||||| |
|
|
| T |
35012 |
ttttgatccctgtaaatatgtctcgttttggttttggtccc |
34972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 57; Significance: 1e-23; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 75540 - 75631
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
75540 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgacacgtgtgcaaat |
75631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 75766 - 75711
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
75766 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
75711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Original strand, 75357 - 75418
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
75357 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaa |
75418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 57; Significance: 1e-23; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 388 - 480
Target Start/End: Complemental strand, 2727 - 2635
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
2727 |
tattttgcagagacctttttaaaaatcaaaagattttgcagggactatttatctaataaatgagttcagtcatcatgtgccacgtgtgcaaat |
2635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 263 - 321
Target Start/End: Original strand, 2496 - 2554
Alignment:
| Q |
263 |
taataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
2496 |
taataggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccc |
2554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 2883 - 2830
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccc |
2830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 56; Significance: 5e-23; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 82710 - 82647
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
82710 |
aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
82647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 82566 - 82471
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||| || |||||| | || | |||||||||| ||| |||||||||||| |
|
|
| T |
82566 |
tattttgcagggacctttttcaaaatcaaaagattttgcagggactatttctcttataaattggtttagtcatcatgtgccacgtgtgcaaatcat |
82471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 82340 - 82394
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
82340 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccc |
82394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 388 - 483
Target Start/End: Complemental strand, 148112 - 148017
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||| ||| |||||| ||||||||||||||||||| ||||||||| || ||| ||||| |||| |||||||||| ||| |||||||||||| |
|
|
| T |
148112 |
tattttgcagggatctttttcaaaatcaaaagattttgcatggactatttctctaatcaatgggttcagtcatcatgtgccacgtgtgcaaatcat |
148017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 148282 - 148223
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
148223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 147889 - 147940
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
147889 |
aggctaaaatatggttttg-tccctgcaaatat--ctcgttttagttttagtccc |
147940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 3293 - 3232
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
3293 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaa |
3232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 50; Significance: 2e-19; HSPs: 4)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 388 - 461
Target Start/End: Complemental strand, 27224 - 27151
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatc |
461 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||| ||||| |||| ||||| |
|
|
| T |
27224 |
tattttgcagggacctttttaaaactcaaaagattttgcagggactatttttctaatgaatgggttcagtcatc |
27151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 27366 - 27305
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
27366 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
27305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 281 - 321
Target Start/End: Original strand, 27072 - 27112
Alignment:
| Q |
281 |
ttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccc |
27112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 310
Target Start/End: Original strand, 26998 - 27042
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
310 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||| ||||||||| |
|
|
| T |
26998 |
taggctcaaatttggttttggtccctgcaaatatgtctcgttttg |
27042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 2777 - 2837
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2777 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
2837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 49; Significance: 8e-19; HSPs: 5)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 49854 - 49945
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||| |
|
|
| T |
49854 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgcgtgcaaat |
49945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 388 - 480
Target Start/End: Original strand, 54955 - 55046
Alignment:
| Q |
388 |
tattttgcatggacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaat |
480 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||| |||| |||||||||| ||| |||||||| |
|
|
| T |
54955 |
tattttgcagggaccttttacaaaatcaaaagattttgcagggactatttctctaataaatgg-ttcagtcatcatgtgccacgcgtgcaaat |
55046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 54814 - 54874
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54814 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaa |
54874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 50075 - 50025
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
50025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 55176 - 55126
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
55126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 49; Significance: 8e-19; HSPs: 3)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 366274 - 366214
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
366274 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
366214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 365979 - 366038
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgtaaa |
366038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 432
Target Start/End: Original strand, 366055 - 366097
Alignment:
| Q |
390 |
ttttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
366055 |
ttttgcagggacctttttaaaaaacaaaatattttgcagggac |
366097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 9028 - 8969
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
8969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 270 - 327
Target Start/End: Original strand, 8734 - 8791
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
8791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 14695 - 14750
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14695 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
14750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 327
Target Start/End: Complemental strand, 15013 - 14953
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaaa |
14953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 48; Significance: 3e-18; HSPs: 3)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 399 - 478
Target Start/End: Complemental strand, 3964 - 3885
Alignment:
| Q |
399 |
gacctttttaaaaatcaaaagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaa |
478 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| || |||||||| |||| |||||||||| ||| ||||||| |
|
|
| T |
3964 |
gacctttttcaaaatcaaaagattttgcagggactatttctctaataaatgagttcagtcatcatgtgccacgtgtgcaa |
3885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 327
Target Start/End: Original strand, 3748 - 3811
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| | |||||||||||| |||| ||||| |
|
|
| T |
3748 |
aataggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgtaaa |
3811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 265 - 319
Target Start/End: Complemental strand, 4082 - 4028
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
4082 |
ataggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 46; Significance: 5e-17; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 4289 - 4236
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4289 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
4236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 320
Target Start/End: Complemental strand, 19471 - 19418
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19471 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
19418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 4039 - 4093
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4039 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 19221 - 19275
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
19221 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 5208 - 5268
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
5208 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaa |
5268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 5228 - 5288
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
5228 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaa |
5288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 44; Significance: 8e-16; HSPs: 3)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 267 - 326
Target Start/End: Complemental strand, 3919 - 3860
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaa |
326 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
3919 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
3860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 3532 - 3584
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
3584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 3698 - 3741
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
3698 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
3741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 44; Significance: 8e-16; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 268 - 327
Target Start/End: Original strand, 12182 - 12241
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaa |
12241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 12536 - 12484
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
12484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 1310 - 1364
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
1310 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
1364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 1645 - 1591
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1645 |
aggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccc |
1591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 8546 - 8600
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8546 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccc |
8600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 290 - 236
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
290 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 265 - 327
Target Start/End: Original strand, 94054 - 94116
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||| |||| ||||| |
|
|
| T |
94054 |
ataggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaaa |
94116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 264 - 321
Target Start/End: Original strand, 24368 - 24425
Alignment:
| Q |
264 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| |||||||||||||||||||| |
|
|
| T |
24368 |
aataggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccc |
24425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 34931 - 34984
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccc |
34984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 327
Target Start/End: Complemental strand, 18045 - 17984
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
18045 |
taggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgtaaa |
17984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 4312 - 4260
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtcc |
4260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 275 - 321
Target Start/End: Original strand, 4016 - 4062
Alignment:
| Q |
275 |
atatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccc |
4062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 12525 - 12577
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
12577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 260 - 320
Target Start/End: Complemental strand, 8650 - 8590
Alignment:
| Q |
260 |
ttttaataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
8650 |
ttttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 320
Target Start/End: Original strand, 8329 - 8382
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
8329 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 5398 - 5450
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
5398 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 5709 - 5655
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccc |
321 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
5709 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccc |
5655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 10168 - 10220
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
320 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 265 - 327
Target Start/End: Complemental strand, 10518 - 10456
Alignment:
| Q |
265 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || |||||||||||||| || ||||| |
|
|
| T |
10518 |
ataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgtaaa |
10456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 17966 - 17907
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaaa |
17907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 269 - 327
Target Start/End: Original strand, 17651 - 17709
Alignment:
| Q |
269 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccccgtaaa |
327 |
Q |
| |
|
||||||||||| |||| |||||| |||||||| || ||||| ||||||||||| ||||| |
|
|
| T |
17651 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgtaaa |
17709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 2)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 417 - 483
Target Start/End: Complemental strand, 7141 - 7075
Alignment:
| Q |
417 |
aagattttgcagggactatttttcaaataaatggattcaatcatcatgtgtcacatgtgcaaatcat |
483 |
Q |
| |
|
||||||||||||| |||||||||| ||||| || ||| ||||||||||||||||||||||||||| |
|
|
| T |
7141 |
aagattttgcaggaactatttttctaataactgagttccgtcatcatgtgtcacatgtgcaaatcat |
7075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 267 - 316
Target Start/End: Complemental strand, 7265 - 7216
Alignment:
| Q |
267 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||| || |||||||||||| |
|
|
| T |
7265 |
aggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta |
7216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 262 - 299
Target Start/End: Complemental strand, 30972 - 30935
Alignment:
| Q |
262 |
ttaataggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30972 |
ttaataggctaaaatatggttttggtccctgcaaatat |
30935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 268 - 316
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
316 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || ||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 271 - 318
Target Start/End: Complemental strand, 5067 - 5020
Alignment:
| Q |
271 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
5067 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Original strand, 11196 - 11239
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
11196 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
11239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 33156 - 33113
Alignment:
| Q |
389 |
attttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
33156 |
attttgcagggacctttttaaaaaacaaaatattttgcagggac |
33113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 268 - 318
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
| Q |
268 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
||||||||||| ||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 299
Target Start/End: Original strand, 9920 - 9953
Alignment:
| Q |
266 |
taggctaaaatatggttttgatccctgcaaatat |
299 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
9920 |
taggctaaaatatgcttttgatccctgcaaatat |
9953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0428 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0428
Description:
Target: scaffold0428; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 392 - 432
Target Start/End: Complemental strand, 7721 - 7681
Alignment:
| Q |
392 |
ttgcatggacctttttaaaaatcaaaagattttgcagggac |
432 |
Q |
| |
|
||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
7721 |
ttgcagggacctttttaaaaaacaaaatattttgcagggac |
7681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 270 - 318
Target Start/End: Original strand, 17126 - 17174
Alignment:
| Q |
270 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
318 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| | |||||||||||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagt |
17174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University