View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5152-Insertion-5 (Length: 120)
Name: NF5152-Insertion-5
Description: NF5152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5152-Insertion-5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 43607129 - 43607241
Alignment:
| Q |
8 |
cacccctctgttcattttcttcagccccattttgttagctgcggctgtcgtcattggtttggccatcgccggatttttgacatccggtgctttcggtatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607129 |
cacccctctgttcattttcttcagccccattttgttagctgcggctgtcgtcattggtttggccatcgccggatttttgacatccggtgctttcggtatt |
43607228 |
T |
 |
| Q |
108 |
acctcgctttctt |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43607229 |
acctcgctttctt |
43607241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University