View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5152-Insertion-6 (Length: 141)
Name: NF5152-Insertion-6
Description: NF5152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5152-Insertion-6 |
 | |
|
| [»] scaffold0055 (6 HSPs) |
| |
|
| [»] scaffold0052 (6 HSPs) |
| |
|
| [»] scaffold0021 (2 HSPs) |
| |
|
| [»] scaffold0061 (1 HSPs) |
| |
|
| [»] scaffold0017 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0055 (Bit Score: 122; Significance: 6e-63; HSPs: 6)
Name: scaffold0055
Description:
Target: scaffold0055; HSP #1
Raw Score: 122; E-Value: 6e-63
Query Start/End: Original strand, 8 - 141
Target Start/End: Original strand, 13658 - 13791
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13658 |
gttggtcccttctcggaaaaacttgtgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatggctgcatgcctcg |
13757 |
T |
|
| Q |
108 |
gcattgtggggtgtgggatgttccgcgatgttgg |
141 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
13758 |
gcattgtggggtgtgggatgttccgtgatgttgg |
13791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #2
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 54680 - 54545
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54680 |
gttggtcccttctcggaaaaacttgtgcgtctccttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
54581 |
T |
|
| Q |
108 |
gcattgtggggtgtggga--tgttccgcgatgttgg |
141 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
54580 |
gcattgtggggtgtgggatgtgttccgcgatgttgg |
54545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #3
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 68323 - 68188
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
68323 |
gttggtcccttctcggaaaaacttgtgcgtctccttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
68224 |
T |
|
| Q |
108 |
gcattgtggggtgtggga--tgttccgcgatgttgg |
141 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
68223 |
gcattgtggggtgtgggatgtgttccgcgatgttgg |
68188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #4
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 71243 - 71108
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
71243 |
gttggtcccttctcggaaaaacttgtgcgtctccttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
71144 |
T |
|
| Q |
108 |
gcattgtggggtgtggga--tgttccgcgatgttgg |
141 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
71143 |
gcattgtggggtgtgggatgtgttccgcgatgttgg |
71108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #5
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 52787 - 52652
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52787 |
gttggtcccttctcgggaaaacttgtgcgtctccttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
52688 |
T |
|
| Q |
108 |
gcattgtggggtgtggga--tgttccgcgatgttgg |
141 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
52687 |
gcattgtggggtgtgggatgtgttccgcgatgttgg |
52652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #6
Raw Score: 85; E-Value: 7e-41
Query Start/End: Original strand, 8 - 104
Target Start/End: Complemental strand, 33613 - 33517
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcc |
104 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33613 |
gttggtcccttctcggaaacacttgtgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccctatgcctgcatgcc |
33517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052 (Bit Score: 122; Significance: 6e-63; HSPs: 6)
Name: scaffold0052
Description:
Target: scaffold0052; HSP #1
Raw Score: 122; E-Value: 6e-63
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 70877 - 70744
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
70877 |
gttggtcccttctcggaaaaacttgtgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatggctgcatgcctcg |
70778 |
T |
|
| Q |
108 |
gcattgtggggtgtgggatgttccgcgatgttgg |
141 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
70777 |
gcattgtggggtgtgggatgttccgtgatgttgg |
70744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #2
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 29087 - 28952
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29087 |
gttggtcccttctcggaaaaacttgtgcgtctccttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
28988 |
T |
|
| Q |
108 |
gcattgtggggtgtggga--tgttccgcgatgttgg |
141 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
28987 |
gcattgtggggtgtgggatgtgttccgcgatgttgg |
28952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #3
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 49695 - 49560
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49695 |
gttggtcccttctcggaaaaacttgtgcgtctccttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
49596 |
T |
|
| Q |
108 |
gcattgtggggtgtggga--tgttccgcgatgttgg |
141 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
49595 |
gcattgtggggtgtgggatgtgttccgcgatgttgg |
49560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #4
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 19815 - 19680
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19815 |
gttggtcccttctcgggaaaacttgtgcgtctccttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
19716 |
T |
|
| Q |
108 |
gcattgtggggtgtggga--tgttccgcgatgttgg |
141 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
19715 |
gcattgtggggtgtgggatgtgttccgcgatgttgg |
19680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #5
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 52286 - 52152
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52286 |
gttggtcccttctcggaaaa-cttgtgcgtctccttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
52188 |
T |
|
| Q |
108 |
gcattgtggggtgtggga--tgttccgcgatgttgg |
141 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
52187 |
gcattgtggggtgtgggatgtgttccgcgatgttgg |
52152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #6
Raw Score: 80; E-Value: 7e-38
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 62451 - 62542
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgc |
99 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
62451 |
gttggtcccttctcggaaacacttgtgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccctatgcctgc |
62542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 117; Significance: 5e-60; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 47957 - 47822
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47957 |
gttggtcccttctcggaaaaacttgtgcgtctccttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcg |
47858 |
T |
|
| Q |
108 |
gcattgtggggtgtggga--tgttccgcgatgttgg |
141 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
47857 |
gcattgtggggtgtgggatgtgttccgcgatgttgg |
47822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 33711 - 33658
Alignment:
| Q |
8 |
gttggtcccttctcggaaaaacttgcgcgtctctttaattttcatgcttagcga |
61 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33711 |
gttggtcccttctcggaaaaacttgtgcgtctctttaattttcatgcttagcga |
33658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 91; Significance: 2e-44; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 42 - 141
Target Start/End: Complemental strand, 53806 - 53705
Alignment:
| Q |
42 |
ttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcggcattgtggggtgtggga--tgttccgcgatgtt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53806 |
ttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcggcattgtggggtgtgggatgtgttccgcgatgtt |
53707 |
T |
|
| Q |
140 |
gg |
141 |
Q |
| |
|
|| |
|
|
| T |
53706 |
gg |
53705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 91; Significance: 2e-44; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 42 - 141
Target Start/End: Original strand, 144828 - 144929
Alignment:
| Q |
42 |
ttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcggcattgtggggtgtggga--tgttccgcgatgtt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
144828 |
ttaattttcatgcttagcgaagcggagtcggcgttgttggatgcttccatatgcctgcatgcctcggcattgtggggtgtgggatgtgttccgcgatgtt |
144927 |
T |
|
| Q |
140 |
gg |
141 |
Q |
| |
|
|| |
|
|
| T |
144928 |
gg |
144929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University