View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5153-Insertion-1 (Length: 194)
Name: NF5153-Insertion-1
Description: NF5153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5153-Insertion-1 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 194
Target Start/End: Original strand, 24717693 - 24717879
Alignment:
| Q |
8 |
tgtttcaatccagatattacgccagttcagcttctttgttatttcaacaacaaacatcaaagcacatagctctatagtaaatgcaattgggatgcctata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24717693 |
tgtttcaatccagatattacgccagttcagcttctttgttatttcaacaacaaacatcaaagcacatagctctatagtaaatgcaattgggatgcttata |
24717792 |
T |
|
| Q |
108 |
ttctgcacgaatccacccttaaaattggcatagccatctctgaatatgacttcaatagaagcagataaaggatcaccaaaggtcgag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24717793 |
ttctgcacgaatccacccttaaaattggcatagccatctctgagtatgacttcaatagaagcagatgaaggatcaccaaaggtcgag |
24717879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University