View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5155_low_2 (Length: 341)
Name: NF5155_low_2
Description: NF5155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5155_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 42226003 - 42225669
Alignment:
| Q |
1 |
tcttcacgattcctctttcttgcattatatttcattcatttcatacctcatcccttataatcattttattttagagcttggagatatcatgaccgcagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42226003 |
tcttcacgattcctctttcttgcattatatttcattcatttcatacctcatcccttataatcattttattttagagcttggagatatcatgaccgcagca |
42225904 |
T |
 |
| Q |
101 |
gcagcacatattgctcgaacaattattggtgttataggtcggtactcaagtctcttactttctagttgttacactactaatttatgtgtat----atatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42225903 |
gcagcacatattgctcgaacaattattggtgttataggtcggtactcaagtctcttacttgctagttgttacactactaatttatgtgtatatatatatg |
42225804 |
T |
 |
| Q |
197 |
tatacatatataatttcttaatattcttagttcttagaatcttatggatctttttcttcacaattttcataacttcaggaaatatcatctcgggcttctt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225803 |
tatacatatataatttcttaatattcttagttcttagaatcttatggatctttttcttcacaattttcataacttcaggaaatatcatctcgggcttctt |
42225704 |
T |
 |
| Q |
297 |
gttcttgtccccagtgtaagcttcatctttctctg |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225703 |
gttcttgtccccagtgtaagcttcatctttctctg |
42225669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University