View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5155_low_4 (Length: 293)
Name: NF5155_low_4
Description: NF5155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5155_low_4 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 130 - 293
Target Start/End: Complemental strand, 45343138 - 45342980
Alignment:
| Q |
130 |
cacggccacagttaaaacttaaaactccccacgtgcggttcctctaactaaccatggttaaatccaatccaaccccacaaatctaaaagactaaaacaaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
45343138 |
cacggccacagttaaaacttaaaactccccacgtgcggttcctctaactaaccatggttaaatccaa-----ccccccaaatctaaaagactaaaacaaa |
45343044 |
T |
 |
| Q |
230 |
cacctccttcattttcaatcttatagtctgaaaaacacaaagcataaggcaattcagatattct |
293 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343043 |
accctccttcattttcaattttatagtctgaaaaacacaaagcataaggcaattcagatattct |
45342980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 45343245 - 45343171
Alignment:
| Q |
6 |
gagagatgaagaaacaaaaaaggcgcatttgctttggtagctcatcattaaccaaagagaatgtgaatgatacta |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343245 |
gagagatgaagaaacaaaaaaggcgcatttgctttggtagctcatcattaaccaaagagaatgtgaatgatacta |
45343171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University