View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5155_low_5 (Length: 288)
Name: NF5155_low_5
Description: NF5155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5155_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 175 - 283
Target Start/End: Complemental strand, 26610164 - 26610056
Alignment:
| Q |
175 |
ggattggaaccgcaagagcaattttaccaaattattatgttgtttatgttttacattttgtgtcacattgaaaccacttatttggtttggtatacttagg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26610164 |
ggattggaaccgcaagagcaattttaccaaattattatattgtttatgttttagactttgtgtcacattgaaaccacttatttggttttgtatacttagg |
26610065 |
T |
|
| Q |
275 |
tctcttgtt |
283 |
Q |
| |
|
||||||||| |
|
|
| T |
26610064 |
tctcttgtt |
26610056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 6 - 58
Target Start/End: Complemental strand, 6185960 - 6185908
Alignment:
| Q |
6 |
aggaggagcagagatggtactaagaatgtgttcaagatactatgatggttatg |
58 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6185960 |
aggagcagccgagatggtactaagaatgtgttcaagatactatgatggttatg |
6185908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 6 - 55
Target Start/End: Complemental strand, 4236867 - 4236818
Alignment:
| Q |
6 |
aggaggagcagagatggtactaagaatgtgttcaagatactatgatggtt |
55 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
4236867 |
aggagcagcagagatggtactaagaatgtgttcaaaataccatgatggtt |
4236818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 44
Target Start/End: Complemental strand, 21847718 - 21847680
Alignment:
| Q |
6 |
aggaggagcagagatggtactaagaatgtgttcaagata |
44 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21847718 |
aggagaagcagagatggtactaagaatgtgttcaagata |
21847680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University