View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5155_low_7 (Length: 236)

Name: NF5155_low_7
Description: NF5155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5155_low_7
NF5155_low_7
[»] chr1 (1 HSPs)
chr1 (14-219)||(22379897-22380102)


Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 219
Target Start/End: Original strand, 22379897 - 22380102
Alignment:
14 gagaatgtgttgataatggtgactggaatattcaaaggattgagagggagttcttgaacccatggaggagccatgataaaatgtggtgagagtggttatg 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22379897 gagaatgtgttgataatggtgactggaatattcaaaggattgagagggagttcttgaacccatggaggagccatgataaaatgtggtgagagtggttatg 22379996  T
114 tctgatggttgcatttgtagagacagaatttgtttaatcacgcaaagatgggaaaaagaaaagatagaagatgcaaagaggattgagataaataagatca 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22379997 tctgatggttgcatttgtagagacagaatttgtttaatcacgcaaagatgggaaaaagaaaagatagaagatgcaaagaggattgagataaataagatca 22380096  T
214 ggtagt 219  Q
    ||||||    
22380097 ggtagt 22380102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University