View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5155_low_7 (Length: 236)
Name: NF5155_low_7
Description: NF5155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5155_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 219
Target Start/End: Original strand, 22379897 - 22380102
Alignment:
| Q |
14 |
gagaatgtgttgataatggtgactggaatattcaaaggattgagagggagttcttgaacccatggaggagccatgataaaatgtggtgagagtggttatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22379897 |
gagaatgtgttgataatggtgactggaatattcaaaggattgagagggagttcttgaacccatggaggagccatgataaaatgtggtgagagtggttatg |
22379996 |
T |
 |
| Q |
114 |
tctgatggttgcatttgtagagacagaatttgtttaatcacgcaaagatgggaaaaagaaaagatagaagatgcaaagaggattgagataaataagatca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22379997 |
tctgatggttgcatttgtagagacagaatttgtttaatcacgcaaagatgggaaaaagaaaagatagaagatgcaaagaggattgagataaataagatca |
22380096 |
T |
 |
| Q |
214 |
ggtagt |
219 |
Q |
| |
|
|||||| |
|
|
| T |
22380097 |
ggtagt |
22380102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University