View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5156-Insertion-10 (Length: 172)
Name: NF5156-Insertion-10
Description: NF5156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5156-Insertion-10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 7 - 172
Target Start/End: Original strand, 47036203 - 47036368
Alignment:
| Q |
7 |
acacacaaatcagctcttaaattgatatcagattgcactaggctccttatgtcaaggactatatcatctaacaagtggctatttatttaatagagataaa |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036203 |
acacacaaatcagctcctaaattgatatcagattgcactaggctccttatgtcaaggactatatcatctaacaagtggctatttatttaatagagataaa |
47036302 |
T |
 |
| Q |
107 |
ttccattgctcattactatctattaagtcttctactttcatattactcaaactatttgggacatgt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036303 |
ttccattgctcattactatctattaagtcttctactttcatattactcaaactatttgggacatgt |
47036368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University