View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5156-Insertion-11 (Length: 140)
Name: NF5156-Insertion-11
Description: NF5156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5156-Insertion-11 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 3e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 3e-43
Query Start/End: Original strand, 19 - 140
Target Start/End: Original strand, 53116160 - 53116280
Alignment:
| Q |
19 |
atcactgtcacaatacatagtacacacaggaaatnnnnnnnncattatttcaaaatatattcataaacacactgcaaacaattcaacgtattgaaaacag |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53116160 |
atcactgtcacaatacatagtacacactggaaataaaaaaa-cattatttcaaaatatattcataaacacactgcaaacaattcaacgtattgaaaacag |
53116258 |
T |
 |
| Q |
119 |
agtttgttttccacgaagctag |
140 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53116259 |
agtttgttttccacgaagctag |
53116280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 9e-28
Query Start/End: Original strand, 70 - 140
Target Start/End: Original strand, 53102978 - 53103048
Alignment:
| Q |
70 |
aaaatatattcataaacacactgcaaacaattcaacgtattgaaaacagagtttgttttccacgaagctag |
140 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53102978 |
aaaaaatattcataaacacactgcaaacaattcaacgtattgaaaacagagtttgttttccactaagctag |
53103048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University