View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5156-Insertion-13 (Length: 172)
Name: NF5156-Insertion-13
Description: NF5156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5156-Insertion-13 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 9e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 9e-78
Query Start/End: Original strand, 6 - 172
Target Start/End: Original strand, 8944873 - 8945038
Alignment:
| Q |
6 |
catcaatttcaatttttccgtctctatttttaatctgtggattcaacttttttcattagtggtaaactatattcatctctaaattaacttggttagactc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
8944873 |
catcaatttcaatttttccgtctctatttttaatctgtg-attcaacttttttcattagtggtaaacgatattcatctctaaattaactttgttagactc |
8944971 |
T |
|
| Q |
106 |
attatcactcatcacattatttcaatatatgaaaaatggatgcatatccttggtttattgcaccccc |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8944972 |
attatcactcatcacattatttcaatatatgaaaaatggatgcatatccttggtttactgcaccccc |
8945038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University