View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5156-Insertion-4 (Length: 114)

Name: NF5156-Insertion-4
Description: NF5156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5156-Insertion-4
NF5156-Insertion-4
[»] chr3 (1 HSPs)
chr3 (23-110)||(19270486-19270573)
[»] chr5 (4 HSPs)
chr5 (8-92)||(1580751-1580835)
chr5 (8-92)||(1603980-1604064)
chr5 (19-108)||(1587235-1587324)
chr5 (19-108)||(1590899-1590988)
[»] chr7 (1 HSPs)
chr7 (61-108)||(39616233-39616280)


Alignment Details
Target: chr3 (Bit Score: 63; Significance: 7e-28; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 63; E-Value: 7e-28
Query Start/End: Original strand, 23 - 110
Target Start/End: Original strand, 19270486 - 19270573
Alignment:
Q  23 gatgacaaattttccttatcttgnnnnnnnggtttcatcttcttcgtgctctttggtttcactcttctttctgcgtaagacatgcttc 110  Q
    |||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  19270486 gatgacaaattttccttatcttgtttttttggtttcatcttcttcgtgctctttggtttcactcttctttctgcgtgagacatgcttc 19270573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 2e-16; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 8 - 92
Target Start/End: Complemental strand, 1580835 - 1580751
Alignment:
Q  8 aatattggccaaggtgatgacaaattttccttatcttgnnnnnnnggtttcatcttcttcgtgctctttggtttcactcttcttt 92  Q
    |||||||||  |||||||||||| ||||||||||||||       |||  |||||||||||||||||||||||||||||||||||    
T  1580835 aatattggcggaggtgatgacaatttttccttatcttgtttttttggtaccatcttcttcgtgctctttggtttcactcttcttt 1580751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 1603980 - 1604064
Alignment:
Q  8 aatattggccaaggtgatgacaaattttccttatcttgnnnnnnnggtttcatcttcttcgtgctctttggtttcactcttcttt 92  Q
    |||||||||  |||||||||||| ||||||||||||||       |||  |||||||||||||||||||||||||||||||||||    
T  1603980 aatattggcggaggtgatgacaatttttccttatcttgtttttttggtaccatcttcttcgtgctctttggtttcactcttcttt 1604064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 108
Target Start/End: Complemental strand, 1587324 - 1587235
Alignment:
Q  19 aggtgatgacaaattttccttatcttgnnnnnnnggtttcatcttcttcgtgctctttggtttcactcttctttctgcgtaagacatgct 108  Q
    |||||||||||||||||||||||| ||       ||||| |||||||||||| |||||||||| |||||||||||  | |||||||||||    
T  1587324 aggtgatgacaaattttccttatcatgtttttttggtttgatcttcttcgtggtctttggtttaactcttctttccacataagacatgct 1587235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 108
Target Start/End: Original strand, 1590899 - 1590988
Alignment:
Q  19 aggtgatgacaaattttccttatcttgnnnnnnnggtttcatcttcttcgtgctctttggtttcactcttctttctgcgtaagacatgct 108  Q
    |||||||||||||||||||||||| ||       ||||| |||||||||||| |||||||||| || |||||||| || ||| |||||||    
T  1590899 aggtgatgacaaattttccttatcatgtttttttggtttgatcttcttcgtggtctttggtttaacacttctttccgcataaaacatgct 1590988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 61 - 108
Target Start/End: Original strand, 39616233 - 39616280
Alignment:
Q  61 cttcttcgtgctctttggtttcactcttctttctgcgtaagacatgct 108  Q
    |||||||||| |||||||||||  ||||||||| || |||||||||||    
T  39616233 cttcttcgtggtctttggtttcgttcttctttccgcataagacatgct 39616280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University