View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5156-Insertion-9 (Length: 245)
Name: NF5156-Insertion-9
Description: NF5156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5156-Insertion-9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 245
Target Start/End: Original strand, 45761971 - 45762208
Alignment:
| Q |
8 |
cttaatcacatgcaaaatcagtggtgtccaaatttcagcagttattagttacacaattagtggaattgccttaagcactccactactaggtatttatcac |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45761971 |
cttaatcacatgcaaaatcattggtgtccaaatttcagcagttattagttacacaattagtggaattgccttaagcactccactattaggtatttatcac |
45762070 |
T |
|
| Q |
108 |
ccactcctccaccctttcattctctatatgcaccgttttactttgaatattggctttgtttgtttgagagagttatggacaacnnnnnnntgaatcctag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
45762071 |
ccactcctccaccctttcattctctatatgcaccgttttactttgaatattggctttgtttttttgagagagttatggacaacaaaaaaatgaatcctag |
45762170 |
T |
|
| Q |
208 |
gagagatgttgaaagtggtaggacaaaaaccaattgtt |
245 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
45762171 |
gagagatgttgaaagtggcaggacaaaaaacaattgtt |
45762208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University