View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5156_low_7 (Length: 239)
Name: NF5156_low_7
Description: NF5156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5156_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 39979182 - 39978975
Alignment:
| Q |
15 |
caaagggagagcgagagtgagtgcagttattatacatattcctagtaagtgggagagatatggcgaagtggtgtatgttgttgttggttcttgctcttgt |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39979182 |
caaagggagagtgagagtgagtgcagttattatacatattcctagtaagtgggagagatatggcgaagtggtgtatgttgttgttggttcttgctcttgt |
39979083 |
T |
 |
| Q |
115 |
tgtggctacaacaagtgcaagaaatgtaccaactgatgctggtttgaaggaccagaagaacttcatgacatttgctggtggttattctggaataggaaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39979082 |
tgtggctacaacaagtgcaagaaatgtaccaactgatgctggtttgaaggaccagaagaacttcatgacatttgctggtggttattctggaataggaaac |
39978983 |
T |
 |
| Q |
215 |
aatggact |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
39978982 |
aatggact |
39978975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University