View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5157-Insertion-5 (Length: 61)
Name: NF5157-Insertion-5
Description: NF5157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5157-Insertion-5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 54; Significance: 8e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 8 - 61
Target Start/End: Original strand, 25131978 - 25132031
Alignment:
| Q |
8 |
gttagggcatatccctttgttacaaccctgctgtgtctcttatggaaatttctc |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25131978 |
gttagggcatatccctttgttacaaccctgctgtgtctcttatggaaatttctc |
25132031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University