View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5157_low_3 (Length: 286)
Name: NF5157_low_3
Description: NF5157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5157_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 20 - 266
Target Start/End: Original strand, 43559044 - 43559290
Alignment:
| Q |
20 |
gccccaacaacaaatgttgggagacaatgttggagctacaacattgtactggtgatattgttacatttttccttaatggtcagacacatcttggatctgg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43559044 |
gccccaacaacaaatgttgggagacaatgttggagcttcaacattgtactggtgatattgttacatttttccttaatggtcagacacatcttggatctgg |
43559143 |
T |
 |
| Q |
120 |
ttgttgtaatgctcttcttactatagctcaagaatgttggggaaatttgcttacctcgttgggtctaacggtagaagaagctgaaattctacgtggcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43559144 |
ttgttgtaatgctcttcttactatagctcaagaatgttggggaaatttgcttacctcgttgggtctcacggtagaagaagctgaaattctacgtggcttt |
43559243 |
T |
 |
| Q |
220 |
tgtgctcgtgttgcctctgttaacaattctcttttaccatctatcac |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43559244 |
tgtgctcgtgttgcctctgttaacaattctcttttaccatctatcac |
43559290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University