View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5158_high_16 (Length: 323)
Name: NF5158_high_16
Description: NF5158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5158_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 10 - 295
Target Start/End: Original strand, 36364002 - 36364287
Alignment:
| Q |
10 |
ccacagaacgctactgcgtacaacggtaatcttgttaagaagattcttaataacggtgggacccctttaagaccgaatgcgaatctgaccgtttatttgt |
109 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36364002 |
ccacagaacgctgctgcgtacaacggtaatcttgttaagaagattcttaacaacggtgggacccctttaagaccgaatgcgaatctgaccgtttatttgt |
36364101 |
T |
 |
| Q |
110 |
ttgcactttttaatgagaatgggaaagtgggacctacttcggagaggaattttgggatgttttatcctgatatgaagaaagtttatgatgttccgtttac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36364102 |
ttgcactttttaatgagaatgggaaagtgggacttacttcggagaggaattttgggatgttttatcctgatatgaagaaagtttatgatgttccgtttac |
36364201 |
T |
 |
| Q |
210 |
cgtggcggggttgaagagttaccgtgacgttccggcgccgggaagtggctgagctgaactcagtgatttattcattgctttgtaat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36364202 |
cgtggcggggttgaagagttaccgtgacgttccggcgccgggaagtggctgagctgaactgagtgatttattcattgctttgtaat |
36364287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University