View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5160-Insertion-4 (Length: 141)
Name: NF5160-Insertion-4
Description: NF5160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5160-Insertion-4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 6 - 141
Target Start/End: Original strand, 5061529 - 5061664
Alignment:
| Q |
6 |
cagttttcgtatagtttatcggtgaggttacggagcacgacatccggcatgacagtgagagcatccgccatggaaacatgttgaaatcagaaacgaaccc |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5061529 |
cagttttcgtatagtttatcggcaaggttacagagcacgacatccggcatgacagtgagatcatccgccatggaaacaggttgaaatcagaaacgaaccc |
5061628 |
T |
|
| Q |
106 |
ttatttcaaaaaacgcagccatagtccaccaccaca |
141 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5061629 |
ttatttcttaaaacgcagccatagtccaccaccaca |
5061664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 4e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 4e-27
Query Start/End: Original strand, 9 - 98
Target Start/End: Original strand, 11370911 - 11371000
Alignment:
| Q |
9 |
ttttcgtatagtttatcggtgaggttacggagcacgacatccggcatgacagtgagagcatccgccatggaaacatgttgaaatcagaaa |
98 |
Q |
| |
|
|||||||| || ||||||| |||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11370911 |
ttttcgtagagcttatcggcgaggttacggagcacggcggccggcatgacagtgagagcatccgccatggaaacaggttgaaatcagaaa |
11371000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University