View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5160_high_16 (Length: 252)
Name: NF5160_high_16
Description: NF5160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5160_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 17728383 - 17728599
Alignment:
| Q |
19 |
gataataatatagaacttagtgatgggtctgagctcgtactcactaagatgtctggtgacaaaaaatcaactagaactctaggttcccgtgaatacttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17728383 |
gataataatatagaacttagtgatgggtctgagctcgtactcactaagatgtctggtgacaaaaaatcaactagaactctaggttcccgtgaatacttgc |
17728482 |
T |
 |
| Q |
119 |
gttattatcgtcagaaaccacgtccatcacccgtgaataacattgccattattgctgaattggctgcaaggtttgtcattttaaaacccgcactctattt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17728483 |
gttattatcgtcagaaaccacgtccatcacccgcgaataacattgccattattgctgaattggctgcaaggtttgtcattttaaagcccgcactctattt |
17728582 |
T |
 |
| Q |
219 |
ttctgtttaattctgtg |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
17728583 |
ttctgtttaattctgtg |
17728599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 1511628 - 1511846
Alignment:
| Q |
19 |
gataataatatagaacttagtgatgggtctgagctcgtactcactaagatgtctggtgacaaaaaatcaactagaactctaggttcccgtgaatacttgc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1511628 |
gataataatatagaacttagtgatgggtctgagctcgtaatcactaagatgtctggtgacaaaaaatcaacgagaactctaggttcccgtgaatacttgc |
1511727 |
T |
 |
| Q |
119 |
gttattatcgtcagaaaccacgtccatcacccgtgaataacattgccattattgctgaattggctgcaaggtttgtcattttaaaacccgcactctattt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||| ||| |||||||||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
1511728 |
gttattatcgtcagaaaccacgtccatcaccagcaaataacattgccattactgcggaattggctgcaaggtttgtaattttaaaacccgtagtctattt |
1511827 |
T |
 |
| Q |
219 |
ttctgtttaattctgtgct |
237 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
1511828 |
ttctgtttaatgctgtgct |
1511846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University