View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5160_high_3 (Length: 463)
Name: NF5160_high_3
Description: NF5160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5160_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 424; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 424; E-Value: 0
Query Start/End: Original strand, 11 - 446
Target Start/End: Original strand, 50437111 - 50437546
Alignment:
| Q |
11 |
gatgaacatggatattgtggattattacgtttgagatgtattggagtgtgatgcaaccgtggccggtgatttgaacatttgcgccgcgaccgtcgacggt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50437111 |
gatgaacatggatattgtggattattacgtttgagatgtattggagtgtgatgcaaccgtggccggtgatttgaacatttgcgccgcgaccgtcgacggt |
50437210 |
T |
 |
| Q |
111 |
tttgtaagaattgaagatgagttcgtgacggaggtttattgtcatggatgaggagaagattatccagagtggttcgtcttgaatcacggcgtgacggagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50437211 |
tttgtaagaattgaagatgagttcgtgacggaggtttattgtcatggaagaggagaagattatccagagtggttcgtcttgaatcacggcgtgacggagt |
50437310 |
T |
 |
| Q |
211 |
gttcctggaactggatttgctgggtcgttgtcggaggaatctgttactatgtagatctgacctcctttacctcccatggcggcgcgaccgaaaccaattc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50437311 |
gttcctggaactggatttgctgggtcgttgtcggaggaatctgttactatgtagatctgacctcctttacctcccatggcggcgcgaccgaaaccaattc |
50437410 |
T |
 |
| Q |
311 |
cgcattccgctaatttctgacggtttgtggaccagtttgggtcgcatcgccagcaatcgtctaccgggtttccagttaaacaagcaccttggtcttttga |
410 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50437411 |
cgcattccgctaatttctgacggtttgcggaccagtttgggtcgcatcgccagcaatcgtctaccgggtttccagttaaacaagcaccttgatcttttga |
50437510 |
T |
 |
| Q |
411 |
gaggagttcccttcttgaaaatgacacattgatttt |
446 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50437511 |
gaggagttcccttcttgaaaatgacacattgatttt |
50437546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University