View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5160_low_20 (Length: 227)
Name: NF5160_low_20
Description: NF5160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5160_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 52116510 - 52116714
Alignment:
| Q |
1 |
tcatcagatgttttgctaagcaccttgatgaggagatgattgctctttaccttggccagttcggagctaggctgaccaaactttcgaaagatcaaatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52116510 |
tcatcagatgttttgctaagcaccttgatgaggagatgattgctctttaccttggccagttcggagctaggctgaccaaactttcgaaagatcaaatgaa |
52116609 |
T |
|
| Q |
101 |
ttacatcattgaacatccatac-------aagcaagctcactataggtacctgagatgatcaagggattacaaagagaaaaataaaatgattctatctgt |
193 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52116610 |
ttacatcattgaacatccatacaagctttaagcaagctcactatatgta-ctgagatgatcaagggattacaaagagaaaaataaaatgattctatctgt |
52116708 |
T |
|
| Q |
194 |
attgtt |
199 |
Q |
| |
|
|||||| |
|
|
| T |
52116709 |
attgtt |
52116714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University