View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5161-Insertion-10 (Length: 438)
Name: NF5161-Insertion-10
Description: NF5161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5161-Insertion-10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 8 - 405
Target Start/End: Complemental strand, 20014800 - 20014413
Alignment:
| Q |
8 |
ggttgatccaaatggacaattctctttgaaaacgggttcttgaagacaagtatggcattcatattgtgtgatatgccatttttagaaagatttgcaaagg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20014800 |
ggttgatccaaatggacaattctctttgaaaacgggttcttgaagacaagtatgacattcatattgtgtgatatggcatttttagaaagatttgcaaagg |
20014701 |
T |
|
| Q |
108 |
tttttgaagacaagtatgacatctatattgtgttattgttttcaatttggcgaatttggagggagcgaaacgattgaattttcaaagtgttatcttgaca |
207 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20014700 |
tttttgaagacaagtatggcatccatattgtgttattgttttcaatttggcgaatttggagggag-----cgattgaattttcaaagtgttatcttgaca |
20014606 |
T |
|
| Q |
208 |
atagagtttaagcaaaggaaagattgcatcatgtttattctatgagctggcaccaagggattcttattttannnnnnnnngaaggaaggaggaaagggat |
307 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
20014605 |
atagagtttaagcaaaggaaatattgcatcatgtttattctatgagctggcaccaagggattcttttttt----ttttttgaaggaaggaggaaagggat |
20014510 |
T |
|
| Q |
308 |
tcttattatttgctaccaaaaaccttatagatttatagattttatgggttggcataggttctaaactgggtgctcaattgtgcgtaggggtgttaatg |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20014509 |
tcttattatttgctaccaaaaaccttaaagatttatagattttatgggttggcataggtactaaactgggtgctcaattgtgcgta-gggtgttaatg |
20014413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University