View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5161-Insertion-6 (Length: 149)
Name: NF5161-Insertion-6
Description: NF5161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5161-Insertion-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 6e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 6e-57
Query Start/End: Original strand, 22 - 149
Target Start/End: Original strand, 1276107 - 1276234
Alignment:
| Q |
22 |
gattttcctttaaattaatatcatctcagaagatgcgtgttttcaataattttcagttgctaaatatacaatgtaacgtacaaactgcagcccttctctc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1276107 |
gattttcctttaaattaatatcatctcagaagatgcgtgttttcaataattttcagtcgcaaaatatacaatgtaacatacaaactgcagcccttctctg |
1276206 |
T |
|
| Q |
122 |
aacaacctttggaagacaaaatccctgc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1276207 |
aacaacctttggaagacaaaatccctgc |
1276234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 2e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 60 - 146
Target Start/End: Original strand, 11086263 - 11086350
Alignment:
| Q |
60 |
gttttcaataattttcagttgctaaatataca-atgtaacgtacaaactgcagcccttctctcaacaacctttggaagacaaaatccc |
146 |
Q |
| |
|
|||||||||| |||||||| || ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11086263 |
gttttcaatagttttcagtcgcaaaatatacagatgtaacatacaaactgcagcccttctctcaacaacctttggaagacaaaatccc |
11086350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University