View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5161-Insertion-6 (Length: 149)

Name: NF5161-Insertion-6
Description: NF5161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5161-Insertion-6
NF5161-Insertion-6
[»] chr5 (1 HSPs)
chr5 (22-149)||(1276107-1276234)
[»] chr1 (1 HSPs)
chr1 (60-146)||(11086263-11086350)


Alignment Details
Target: chr5 (Bit Score: 112; Significance: 6e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 112; E-Value: 6e-57
Query Start/End: Original strand, 22 - 149
Target Start/End: Original strand, 1276107 - 1276234
Alignment:
22 gattttcctttaaattaatatcatctcagaagatgcgtgttttcaataattttcagttgctaaatatacaatgtaacgtacaaactgcagcccttctctc 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||||     
1276107 gattttcctttaaattaatatcatctcagaagatgcgtgttttcaataattttcagtcgcaaaatatacaatgtaacatacaaactgcagcccttctctg 1276206  T
122 aacaacctttggaagacaaaatccctgc 149  Q
    ||||||||||||||||||||||||||||    
1276207 aacaacctttggaagacaaaatccctgc 1276234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 64; Significance: 2e-28; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 60 - 146
Target Start/End: Original strand, 11086263 - 11086350
Alignment:
60 gttttcaataattttcagttgctaaatataca-atgtaacgtacaaactgcagcccttctctcaacaacctttggaagacaaaatccc 146  Q
    |||||||||| |||||||| || ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
11086263 gttttcaatagttttcagtcgcaaaatatacagatgtaacatacaaactgcagcccttctctcaacaacctttggaagacaaaatccc 11086350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University