View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5161-Insertion-7 (Length: 143)
Name: NF5161-Insertion-7
Description: NF5161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5161-Insertion-7 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 41 - 143
Target Start/End: Original strand, 10153246 - 10153348
Alignment:
| Q |
41 |
tctctctcatacgagatcaatgacttgaatcgcacgttactctcacgttcctcccaaaaccttatatatagagagcgctaatagaaaattaacaaattat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10153246 |
tctctctcatacgagatcaatgacttgaatcgcacgttactctcacgttcctcccaaaaccttatatatagagagcgctaatagaaaattaacaaattat |
10153345 |
T |
|
| Q |
141 |
cgg |
143 |
Q |
| |
|
||| |
|
|
| T |
10153346 |
cgg |
10153348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University