View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5161_low_15 (Length: 251)
Name: NF5161_low_15
Description: NF5161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5161_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 9 - 234
Target Start/End: Original strand, 7336552 - 7336777
Alignment:
| Q |
9 |
acatcatcaagagaattggaaaatgaagaagatgaagatgatggattcaaaactccaactcattttgataatagaatccaaataccaaagcaatgtccac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336552 |
acatcatcaagagaattggaaaatgaagaagatgaagatgatggattcaaaactccaactcattttgataatagaatccaaataccaaagcaatgtccac |
7336651 |
T |
 |
| Q |
109 |
ttgcaccaagaaaaactaaaccacatatgaaaagaaggaaagcacaatgcaaacaactacttgatgtgtcaagagaagttgaattattgttccaaatcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336652 |
ttgcaccaagaaaaactaaaccacatatgaaaagaaggaaagcacaatgcaaacaactacttgatgtgtcaagagaagttgaattattgttccaaatcaa |
7336751 |
T |
 |
| Q |
209 |
gaacaaaacattttcaagttcacaac |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7336752 |
gaacaaaacattttcaagttcacaac |
7336777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University