View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5162_low_2 (Length: 319)
Name: NF5162_low_2
Description: NF5162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5162_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 22016551 - 22016398
Alignment:
| Q |
1 |
gcaaagtggctatgttacactccttgattaataaacacaaatgtgcagaatggcaaaattattatagcactattaaagccattaagggagactattaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22016551 |
gcaaagtggctatgttacactccttgattaataaacacaaatgtgcagaatggcaaaattattatagca----------------------ctattaaag |
22016474 |
T |
|
| Q |
101 |
ccatatttctagaggatgtgaaactaaagtcaaaacacactcttcacaccagcacaacaaagatactagaggaagc |
176 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016473 |
ccatatttctagatgatgtgaaactaaagtcaaaacacactcttcacaccagcacaacaaagatactagaggaagc |
22016398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 174 - 303
Target Start/End: Complemental strand, 22016363 - 22016230
Alignment:
| Q |
174 |
agctagaggtggattgaaactcaggcagctttt-ccaacacggtatgtatatgctaggagggaaaacaactgaacaacaacaaaaccttttcttactagt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22016363 |
agctagaggtggattgaaactcaggcagctttttccaacacagtacgtacatgctaggagggaaaacaactgaacaacaacaaaaccttttctcactagt |
22016264 |
T |
|
| Q |
273 |
gggcttaactaca---atcaaaacctgtcataaa |
303 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| |
|
|
| T |
22016263 |
cggcttaactacagccatcaaaacctgtcttaaa |
22016230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University