View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5162_low_4 (Length: 239)
Name: NF5162_low_4
Description: NF5162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5162_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 22016586 - 22016815
Alignment:
| Q |
1 |
ttttgtaagtgctgctttgtgatgacttagcatagtgaatttgaaattatctcttactatgcaattcctgatcgatttttgtgttctacgctatttaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016586 |
ttttgtaagtgctgctttgtgatgacttagcatagtgaatttgaaattatctcttactatgcaattcctgatcgatttttgtgttctacgctatttaccg |
22016685 |
T |
 |
| Q |
101 |
aagcctcctcagatgaattgtctggatgaaattcaaccttattgtgaagagcaagcaaaagatgatctatccatggtagaaactgaacgtaatgaaggga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016686 |
aagcctcctcagatgaattgtctggatgaaattcaaccttattgtgaagagcaagcaaaagatgatctatccatggtagaaactgaacgtaatgaaggga |
22016785 |
T |
 |
| Q |
201 |
cagataataatgaaaataatgctgatgatg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22016786 |
aagataataatgaaaataatgctgatgatg |
22016815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 194 - 228
Target Start/End: Original strand, 22016830 - 22016864
Alignment:
| Q |
194 |
gaagggacagataataatgaaaataatgctgatga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016830 |
gaagggacagataataatgaaaataatgctgatga |
22016864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University