View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5163_low_1 (Length: 297)
Name: NF5163_low_1
Description: NF5163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5163_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 20 - 289
Target Start/End: Original strand, 33700479 - 33700748
Alignment:
| Q |
20 |
atttggttgtgttcaatatttgtttggcaggtgggaggtagtgggatatcaaagtggaatccaatatagcccattcccaatccctcagcaaggtctaccc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33700479 |
atttggttgtgttcaatatttgtttggcaggtgggaggtagtgggatatcaaagtggaatccaatatagcccattcccaatccctcagcaaggtctaccc |
33700578 |
T |
|
| Q |
120 |
acaagattttggagaatcaaatagagtcaaagaagactattatatgatgataaaatctatataacnnnnnnnagttattccttgccaccccaacattgat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33700579 |
acaagattttggagaatcaaatagagtcaaagaagactattatatgatgataaaatctatataactttttttagttattccttgccaccccaacattgat |
33700678 |
T |
|
| Q |
220 |
ctcaattgattctctcttttagggagagtatagtctctagttagtctccgagtaccatcatacctatgct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33700679 |
ctcaattgattctctcttttagggagagtatagtctctagttagtctccgagtaccatcatacctatgct |
33700748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University