View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164-Insertion-11 (Length: 200)
Name: NF5164-Insertion-11
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164-Insertion-11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 200
Target Start/End: Original strand, 17257157 - 17257349
Alignment:
| Q |
8 |
gttttggggtgctgctgtacctgttttttctgatggctgctgtccacttttttactgttttgcgcctcatgtgtgcggctgtttccggcctgtgtgctgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17257157 |
gttttggggtgctgctgtacctgttttttctgatggctgctgtccacttttttactgttttgcgcctcatgtgtgcggctgtttccggcctgtgtgctgc |
17257256 |
T |
|
| Q |
108 |
tgttttttgcgcctcacatgtgacaggaagtggttgatcagttttaggaggtcctgtgggtttattaggtgttttttctgctgggtggtttcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17257257 |
tgttttttgcgcctcacatgtgacaggaagtggttgatcagttttaggaggtcctgtgggtttattaggtgttttttctgctgggtggtttcc |
17257349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University