View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164-Insertion-13 (Length: 111)
Name: NF5164-Insertion-13
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164-Insertion-13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 6350384 - 6350281
Alignment:
| Q |
8 |
aatcgaatttttattcacttcttgtccatttcttatcactctaacgtttgtagtgattatacctctagaggtcacttgacacatcttatagaaagcttac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6350384 |
aatcgaatttttattcacttcttgtccatttcttatcactctaacgtttgtagtgattatacctctagaggtcacttgacacatcttatagaaagcttac |
6350285 |
T |
 |
| Q |
108 |
cgcg |
111 |
Q |
| |
|
|||| |
|
|
| T |
6350284 |
cgcg |
6350281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University