View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164-Insertion-8 (Length: 369)
Name: NF5164-Insertion-8
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164-Insertion-8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 153 - 233
Target Start/End: Complemental strand, 2656746 - 2656666
Alignment:
| Q |
153 |
ttagagtgacctgcaaaattatgcaggttgagtgggtttggattaacataagagtgacattgtttgtgtgatttttattca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||| | |||||| |||| | ||||||||||||||| |
|
|
| T |
2656746 |
ttagagtgacctgcaaaattatgcaggttgagtgggtttagcttaacatgaaagtgaccttgtatctgtgatttttattca |
2656666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 351
Target Start/End: Complemental strand, 9593271 - 9593182
Alignment:
| Q |
265 |
agaagacttttagattagacaatgagtcaagaaataagttcacaggttcttcgtaaagttctagtgatc---aattggacatttagctct |
351 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||| ||| || |||||||||| || | |||||||||||||||||| |
|
|
| T |
9593271 |
agaagacttttagaatagacaatgagtcaagaaataaattcacaatttcatcttaaagttctaccgagcaataattggacatttagctct |
9593182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University