View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164_high_12 (Length: 251)
Name: NF5164_high_12
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 4113353 - 4113134
Alignment:
| Q |
1 |
atgttctgttaaacctcattcatttgattttcatattaccaatgttagtggaggaaatatacataccgtgaccctttccaactaatctcagttgagtcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4113353 |
atgttctgttaaacctcattcatttgattttcatattaccaatggtagtggaggaaatatacataccgtgaccctttccaactaatctcagttgagtcac |
4113254 |
T |
|
| Q |
101 |
atactctgatatcttcttaattgattcaacctgtgcaaggaaaatacatataagaacaagaagaaaaaattggaaaatattgatacacttagtaactttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4113253 |
atactctgatatcttcttaattgattcaacctgtgcaaggaaaatacatataagaaca---agaaaaaattggaaaattttgatacacttagtaactttt |
4113157 |
T |
|
| Q |
201 |
ggatctaaagatttttcatgtca |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4113156 |
ggatctaaagatttttcatgtca |
4113134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 57 - 133
Target Start/End: Original strand, 25792490 - 25792566
Alignment:
| Q |
57 |
atatacataccgtgaccctttccaactaatctcagttgagtcacatactctgatatcttcttaattgattcaacctg |
133 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25792490 |
atatacataccatgaccctttccaacccttctcaattgagacacatactctgatatcttcttaattgattcaacctg |
25792566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University