View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164_high_20 (Length: 227)
Name: NF5164_high_20
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 39974257 - 39974037
Alignment:
| Q |
1 |
caattactatattttacttttttctatggccttatccagtaatatcgtcta---ttataatgaagtaagactctggtaacatttatcttatctaattcaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
39974257 |
caattactatattttacttttttctatagccttatccagtaatatcatctagtattataatgaagcaagactctggtaacatttatcttatctaattcta |
39974158 |
T |
 |
| Q |
98 |
nnnnnnnactcagtcttatcaaattctatgaaaacgagataaacatgaaaaatttatatgataagattgaagtatatatggttcacttcacttattattc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39974157 |
tttttttactcagtcttatcaaattctatgaaaacgagataaacatgaaaattttatatgataagattgaaggatatatggttcacttcacttattattc |
39974058 |
T |
 |
| Q |
198 |
ccctgtgaaattgaactgttg |
218 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
39974057 |
ccctgtgaaattgaattgttg |
39974037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University