View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164_low_10 (Length: 295)
Name: NF5164_low_10
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 11 - 279
Target Start/End: Original strand, 48065446 - 48065714
Alignment:
| Q |
11 |
cagagaaagaatgcaaagagttattagcactcggagaagataaagatgaccaataccaaaagcctaaggtggtaccaacaaccacagccccagaagttat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065446 |
cagagaaagaatgcaaagagttattagcactcggagaagataaagatgaccaataccaaaagcctaaggtggtaccaacaaccacagccccagaagttat |
48065545 |
T |
 |
| Q |
111 |
tgtcctaagaaaatactcaaaatctctaaccctttcatcaccaccatttccggacccatcaaaagagctcaacggagaagaagacgaagacgtggagcgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48065546 |
tgtcctaagaaaatactcaaaatctctaaccctttcatcaccaccatttccggacccatcaaaagagctcaacggagaagaagacgatgacgtggagcgt |
48065645 |
T |
 |
| Q |
211 |
tgtgattggctacacaacggccttatgttatgtcgtagagtctgttggaatcttcttccccaagaaaac |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065646 |
tgtgattggctacacaacggccttatgttatatcgtagagtctgttggaatcttcttccccaagaaaac |
48065714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University