View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164_low_11 (Length: 286)
Name: NF5164_low_11
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164_low_11 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 45787344 - 45787074
Alignment:
| Q |
1 |
agtagaatgatttatagggaaatacactgtccggttaaaggggaagaggatctgaagtgtagggttcctccacctcatggttacaagactccttttactt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45787344 |
agtagaatgatttatagggaaagacactgtccggttaaaggggaagaggatctgaagtgtagggttcctccacctcatggttacaagactccttttactt |
45787245 |
T |
 |
| Q |
101 |
ggccggctagtagggatgttgcttggtatgctaatgtccctcaccgtgaactcaccgttgaaaaagctgttcagaattggatccggtacgacggtgatcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45787244 |
ggccggctagtagggatgttgcttggtatgctaatgtccctcaccgtgaactcactgttgaaaaagctgttcagaattggatccggtacgacggtgatcg |
45787145 |
T |
 |
| Q |
201 |
gttcttttttcccggcggtggaaccatgttccctaatggagctggtgcatatattgatgatataggaaagt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45787144 |
gttcttttttcccggcggtggaaccatgttccctaatggagctggtgcatatattgatgatataggaaagt |
45787074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 263
Target Start/End: Complemental strand, 70601 - 70459
Alignment:
| Q |
121 |
gcttggtatgctaatgtccctcaccgtgaactcaccgttgaaaaagctgttcagaattggatccggtacgacggtgatcggttcttttttcccggcggtg |
220 |
Q |
| |
|
||||||||||| ||||| ||| ||||| | | || || |||||||||| ||| ||||||||||| | ||||||||| |||| |||||| || |||| |
|
|
| T |
70601 |
gcttggtatgcaaatgtaccttaccgtcatttaacggtggaaaaagctggtcaaaattggatccgttttgacggtgataagttccgttttcctggtggtg |
70502 |
T |
 |
| Q |
221 |
gaaccatgttccctaatggagctggtgcatatattgatgatat |
263 |
Q |
| |
|
| || ||||| |||||||| |||| | |||||||||||||| |
|
|
| T |
70501 |
gtactatgtttcctaatggtgctgataagtatattgatgatat |
70459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University