View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164_low_13 (Length: 248)
Name: NF5164_low_13
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 29371110 - 29371351
Alignment:
| Q |
1 |
gtaatgaaccattaatttgtccatgtaacatgtaagaaacatatatttctttttcaaatttgtcattatctaaatttaaaatctgatatgcgcagtgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || | |||| |
|
|
| T |
29371110 |
gtaatgaaccattaatttgtccatgtaacatgttagaaacatatatttcttgttcaaatttgtcattatctaaatttaaaatctgatatgtgcggagttt |
29371209 |
T |
 |
| Q |
101 |
gtaataatattatattgattgcaggagaagctttaaattattgctatggcaaatgtccacaagacaaaaacatttgtaatgtttcttgtttaaaacaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29371210 |
gtaataatattatattgattgcaggagaagctttaaattattgttatggcaaatgtccacaagacaaaaacatttgtaatgtttcttgtttaaaacaatt |
29371309 |
T |
 |
| Q |
201 |
gaggtatcctaagggtggc-tctgtagtgacactggtctgtg |
241 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
29371310 |
gaggtatcctaagggtggcttctgtagcgacactggtttgtg |
29371351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University