View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164_low_18 (Length: 238)
Name: NF5164_low_18
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 29494938 - 29495171
Alignment:
| Q |
9 |
ggcgttgatgaacataagtgagtgaaagtgagagtaagtgagtgagtttcatgtcatatttgaagaaaagaaagaaaatggagagattgagtgagaggat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29494938 |
ggcgttgatgaacataagtgagtgaaagtgagagtaagtgagtgagtttcatgtcatatttgaagaaaagaaagaaaatggagagattgagtgagaggat |
29495037 |
T |
 |
| Q |
109 |
atgcat-gggggaggtgtgttacagatagaat------------------aga-gaaagatagagaggtatgtgttgttttgtttgaagaaagaagatga |
188 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29495038 |
atgcatggggggaggtgtgttacagatagaatgaaaaatgacaaaaaatgagaggaaagagagagaggtatgtgttgttttgtttgaagaaagaagatga |
29495137 |
T |
 |
| Q |
189 |
aaaacttaaccgagtcataatatatgcatgggcg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29495138 |
aaaacttaaccgagtcataatatatgcatgggcg |
29495171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University