View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164_low_21 (Length: 206)
Name: NF5164_low_21
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 188
Target Start/End: Original strand, 10023696 - 10023865
Alignment:
| Q |
19 |
agagaccccaaatgccatttaaagaattgaaatgaagggaataatttagaatggtggctaaccaagacaacatttttaaagcaaaatcacattgnnnnnn |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10023696 |
agagaccccaaatgtcatttaaagaattgaaatgaagggaataatttagaatggtggctaaccaagacaacatttttaaagcaaaatcacattgaaaaaa |
10023795 |
T |
|
| Q |
119 |
nngaagataaaaagtggtttcttcactattttggcagcagctgcagactgagggcaaactaacacctctt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10023796 |
aagaagataaaaagtggtttcttcactattttggcagcagctgcagactgagggcaaactaacacctctt |
10023865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University