View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5164_low_8 (Length: 346)
Name: NF5164_low_8
Description: NF5164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5164_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 20 - 330
Target Start/End: Original strand, 4113524 - 4113834
Alignment:
| Q |
20 |
agtaagaactatgtgtagaagaagacctggagccataacaactgtttgtagcttgcaacaattattttgttagaaatgaaaatgacgactttggctatta |
119 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4113524 |
agtaagaactatgtgtagaacaagaactggagccataacaactgtttgtagcttgcaacaattattttgttagaaatgaaaatgacgactttggctatta |
4113623 |
T |
 |
| Q |
120 |
gtttcaattatatgtttggtggtgtgaaaattttcttgcaacacaatcaataaatgcacaactctcattggtgtttcttagggtaagttcaaacaaattg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4113624 |
gtttcaattatatgtttggtggtgtgaaaattttcttgcaacacaatcaataaatgcacaactctcattggtgtttcttagggtaagttcaaacaaattg |
4113723 |
T |
 |
| Q |
220 |
tggttacactacacttttatcaatttccaaacacatgcttagactcgtgagcttgagttttagtcaaactttgttagcttccctgctacctggcctgttt |
319 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4113724 |
tggtgacactacacttttatcaatttccaaacacatgcttagactcgtgagcttgagttttagtcaaactttgttagcttccctgctacctggcctgttt |
4113823 |
T |
 |
| Q |
320 |
ggattgatttg |
330 |
Q |
| |
|
||||||||||| |
|
|
| T |
4113824 |
ggattgatttg |
4113834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University