View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165-Insertion-13 (Length: 61)
Name: NF5165-Insertion-13
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165-Insertion-13 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 55; Significance: 2e-23; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 30299244 - 30299190
Alignment:
| Q |
7 |
acctagctctgtacctttgcacttgttggcttctctcttcttcttgttgttcatc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30299244 |
acctagctctgtacctttgcacttgttggcttctctcttcttcttgttgttcatc |
30299190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 7e-17
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 30291820 - 30291773
Alignment:
| Q |
7 |
acctagctctgtacctttgcacttgttggcttctctcttcttcttgtt |
54 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30291820 |
acctagccctgtacctttgcacttgttggcttctctcttcttcttgtt |
30291773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 7e-17
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 30304454 - 30304407
Alignment:
| Q |
7 |
acctagctctgtacctttgcacttgttggcttctctcttcttcttgtt |
54 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30304454 |
acctagccctgtacctttgcacttgttggcttctctcttcttcttgtt |
30304407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University