View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165-Insertion-9 (Length: 248)
Name: NF5165-Insertion-9
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165-Insertion-9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 248
Target Start/End: Original strand, 37220578 - 37220819
Alignment:
| Q |
7 |
atcactgccattagaatttgacatgattacttacggaaggatgagaggatgggaattgttctatttataataggatttataaagtagttagaggtaaata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37220578 |
atcactgccattagaatttgacatgattacttacggaaggatgagaggatggaaattgttgtatttataataggatttataaagtagttagaggtaaata |
37220677 |
T |
 |
| Q |
107 |
cggagagtttttgttacttcacttnnnnnnnnntattgttgttacaatatactactagctgaatatcaaagatctaaaagataaagttgcaaccagctga |
206 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37220678 |
cggagagtttttgtaacttcacttaaaaaaatatattgttgttacaatatactactagctgaatatcaaagatctaaaagataaagttgaaaccagctga |
37220777 |
T |
 |
| Q |
207 |
atatatcaaagatttaaaagataaagttcaatttgttcgcct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37220778 |
atatatcaaagatttaaaagataaagttcaatttgttcgcct |
37220819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University